Description :
From Genome Similarity Track
Location :
Scaffold_52:10756- 12026
Transcript NameFunction/comments
Phyra_80733Hypothetical protein

Sequence
1270 bases(100 bases per row)
GGTACACATGCCAAGTCCTTTCATACTCCATACAAGCACGGCTAGATCGTCGTACGGGAGCAAAGTTAGCTCTGGCAATTGTTGCTGCGAATTGCTTCAG
TGGTAAACACTCGAAAAGAGTGGTGGGTGATTAAGTGTTTGATTGCATGTTTGAATTCGCGTAAGCTCTAAACCCCAAGCGTACGTTCCGAATGTTGTAC
CGTGCTGGAATCCACAGCACCAGCCAAGATTAAACGAGTCAGCAATATCCCTTCAGAACCTGTACGCAGAGCGCACGATACAGAGTGGGTGGGCCGTTGT
ACGAAGAGCAAGGCAGTGTGTGCGCGGAATACATCCACGTTTTGCTGGAGTTTAGAGGGTTTTACAAGGTGAGACTGCTTGCTAGGATCGTACCAATCTG
GACCGGATGCCCAGCCAGCAAATCGACTGCTGTCGACGGGCATATCTCTCACGCAGCCATGATCCGTGTTCCAGACATAACGTTAGCGTTTTATCGCTGG
AGGAATGTTTTCCTCCGTAAATCGCACCGAGAGGTATTTAGCGAGGTGTACGTCCTTATTTCGGTTGCCGAAAGGGGGAATGTAGTCGCAAGATGGTGGC
TTCACTACGATGCTAGCGGAAACCAATCGCGGGTTGATTCGTATGGTTGTATAGATTGGTTAGTTTGAGAAAGAGGATATGAAAGCCGCTATTGTGTCTG
CTGTAGCGGTGCCGATTCCAATTGAGTCTTGGGTTTTGCGCTGTCTCCTTATTGCCGTTTGTCTCCAGTACGAGGGCCCTCATTGTTCCCAGCGCCAACA
TCGTGGTTATAATGGTGTGAGCCGCTGGAGTTGCCACCACCCGCCTTGCCACTTTTCATGGGCTCTTTCACGTCGTTCGCCCCGTGGTCCCCACTGCCGA
CAGCGGAAGTCCCCCCGTTGCCGCCTGCGTTCGGTGGTGGCGGAAACTGACGGTCTTGGTACGGTGTCTCCTGTTTGGCATTGCTTCCACCCTGCCACGA
CGGCGGAGGACCGTTGCCGTCGTTTTGGAGAGCCTTGCGGTGAACACCATCGCGTTCACGGCGAGGAGACGGAGGTTTGTCGTCGCAGCCTGCCTCAGGT
GGCGGAGGGAAGTGTCCGTCCACGCTACCACTGCCGCGCCGCAATGATCCTGAGCCCATACCGCTCATATCGCTGCCGTGTTTGTGCGGGACGTGAGCAT
CCCGAGCGCGTGGCGATGGCGGAGTTTGGTCGTCGGGTTTGTCGTTTTCGAGGGCCTTGCGGTGCGTCTT