Description :
From Genome Similarity Track
Location :
Scaffold_51:10754- 12544
Transcript NameFunction/comments
Phyci_66548Hypothetical protein

Sequence
1790 bases(100 bases per row)
GCTGGAGGGGGTGCACCGCCAAGCATCGGCGTCTTAAACTTTGCACGGATAAATGCTTGGAAGTGAGGAGCTAACGGATGTTCGGGCGCTAGGTCAAATC
CACGGCTCTTGGGACGTCCCCGTCGAGATGGGTCTTTTCCAGATGAAGCGCACCTCGGCAGTAAATCGACAATCATTTCAAACTCCAAAGCCGAGTCTGC
AGCACGGGCCCCGATGCCGGTACGACTCAGCTTCAGTTACGAGAACCATTTTACCGTTGCCAATACGGTACATGCGAGAACCCGTATTTGTTGTAGCACT
CGTACTTCAAGATGACCGCGCATCATTATCGTCGGCCAATGCGATAAGGTCGTCAATCTCGTCTTGTGCACTCATTTCCTCATCCTCGTGAGTTTTATCT
CCAACGACTTCGGTATCCAATGATTCAGGGGGTACACGCGGTTCGATGGCATCATTCTCGATATATCCAACCAGCTTATTTGGAAAAACAAACCAAAACG
TGTCGCTAGATAGAAACGATCGATACCCAGACAAGGCGTATGCCTTTGACGAGTGTGGCCATTCGTTTCCGCCGCTGAAAGCATTTACCGTGCGGGTTGC
TAGATGCTTTGCAGTTCGCAAACCTGTTCCGCTGTCATCCGCAACGCTACGGTATTTCAGAATCTCGGTCAATGCTGTGTGCATAGCTGCTGCCGCGCGT
TTGAGACCACCTTTCTCCTTCGTCATATAGGACTGTTGATATTCCTCTACCATGTCCCCGGCGTCCTCGCCGTTCGTGATTGCCGAATTGGTGTGTGAAG
CGGTTAGACAGGCAAGCGAAAGATTGGTCTCCACAAACATCGCGTCACGGGCTGGCCGGTGCTGCTCCCATACAATAGCACCACTCGTGTGCTTCCGAAA
AATCCTTTTGTTTGCAAAACTAAGTCTCGCATCAATGCCGTCGGCGATATCCACCGCTACAGGCTTAACGTCAAACACTGCCCGCTGGCGCCTGCCTAGA
ACACTAGCAGCCTTCAGAGTAATACAGAACGGCTGTGTCTTACCCTCATGTATACCCGCGGGCCTCGAAAGACTACACATATGCCGCCCGCGAACACCTT
TACGGCAAGTGGTCGAGTGCGTGTGAATATTCGTCGCTATTGCCCTTTTTGCAGCGGCTCTCATGAACCCATCGTAATCGTTTGCCGCGTCCGGAACCTC
AATTTCGAACGCGCGAGGCATCTTTCCGCCGTGACTCGCCCTCCAATCATCGCACCATTGCCGTACACTGTCCGTCGTAACTGCGCAAGATATAGTGTCT
ATGTATCGACGCGCTTTTGTTAGCAGGTCGGAACAGCACGATATTCGCCTGAGCAAACTAGGATTCACAGCAGATGCATAGAGCGTCATATGAGCGTGTA
ACCGGCCGTCAACTTGAGGCTCGACAACTGCATTAAATGCAGCACACCGGCCGTAAACCCCACATTGAGCAGCTAAATAGCTGGTACTAGCGCGTGTGGA
GCTACAACCACGACACCGAATGATGGCATTGGTCAAGCATGTCAGCTTGCGTTCGAAACCACCGGCCGATAACGCGGGAAATAAAGCTGAGACCGCAAGC
TGCGCCCTAACATTATTTTGAAGCTCCTCGGGTAGATGCGCAAACCGGCATTCCTTTCGTGTATACACACAATTCTCATCGTTCCAGCTTCCCTGTTTTC
GAAGCTCAGCAATTCGGTGAAGTAAGAGGTCATCGTGCTCTGGTGGAGCTAGCGTGATCCAATCCAGGGCTATACCGTACCGATATCTCA