Description :
From Genome Similarity Track
Location :
Scaffold_15:107538- 118209
Transcript NameFunction/comments
Physo_343557transmembrane protein, putative
Physo_534641crinkler (CRN) family protein, putative
Physo_309126Hypothetical protein
Physo_309127Hypothetical protein

Sequence
10671 bases(100 bases per row)
TCCGACCTGGTGCAACCACAGTGTTTCCATCAAAAGTCCGCTCCAAAATGTTGTCGCTTACTACGGATTCCCGTCACGATCGTGGCAGCAACGCGCGCTT
TCTCGAGCGTTGGAACCCACTGTTTCAATGGACTTCCCCATGAGTTCCAGTGCTGGAGACCTCCCATCGAACGATGACCTCCCGATGAATATTTCTATCG
CGACCAACCTGGTTGTTTATGCGGTGGTGGTGAGCAACAGCTTTCTCGGCTGGTGGTCGGAGGAAGACGAGGTATGGAGCTCACGCAGTCAAGGCTTCAA
GACCACCAAATATTCCAAGCCGCTCGTCATGGCCGAATACTTGAATCTAACGAAGCGGTCATCTGCAAACGCGACTTTTGTCAGTGACGTCCAAGAGGTG
GTTGCCGACTACTTCGGGAAGGCTGGTCATGCGAACATCACTGACGAGCTGGCAAGGTTGGCGTTTTCGCGTCTGGATCTGTCGGAGACTGTGGTCTTCG
ATGCATTCACAATTGAGATCCCAACGCAAAAGATCGGTCAGCAGGAGGACAATTCGTCAGAATCGAACCCATTCTACGAAACGCTGAAGGGGCTCGACTG
CAACCCGGAGGCCTGTATCGTGAACGGGGCGAAGGAATTCACGGAAGGCGGCAACGAAACGACAATCTATCCACGTGTACAAGCACTCGCAATCTGTCTC
AACAATAAGGGAACCGAAGATCTGGCTGTGGATATGAACTACTACAATCCCGACCAGTATCTCCAAAATTGCACGAGGCGCTCGACTACTTCAATGATGA
TCGTAAACATTGGCAAGCGTATCGAAGGTGACTCCTTCGAAGCTTCTTAAGTGAACGCGCGCATGGTGTATTCTCTGACGGTGGGGCGGTTATCGTGGAC
GCCGCAGAATCTGTCAGACGTTTATGGAGTTGAATGCGCAAGTGAAGAAGGCTGCGACGGACTTCGGTTTCCACTGGAAACTACCAGTGACCAACTACTT
ATCGGTAGCAGCAGAATCCTGATGGATTTACTCAGTCCCATCAACATGAACGTGAATTATTTTTTCAATTGGTGCGTCGGAGTGGATCGACTGTCGAGGA
AACCAGAGGCGCAAAGCTGAAAACTGACTCTAGCCGAGCACCGATTGCACTACCGCGCAATTTTAAACACACCGACTCGGGTCTCACCACGTACATGCTG
GAACAAGACGGGTCCAAAACCTGCGAGCTCTTGGGCACATCAAACACATCGAGAAGAATCACCTGTACATCGAGCACACTCTGCAGCCAGCATATACAGC
GGGGCTCTACTTTATTTCCCAGGACGCAGTGGTTGTCAAATACCTCCCTTCAAATGCTAGTATCTATTCTGAGGGCATATCCCTGGCGTTTATGGGAAAT
ATCCAAGAGATGAACGTCCAAGCGTACATCCCAACCACGAATATGGTACTAACGGTGGTGGGCTGTGTTGGCATGGTGCTGGGGGGCATTATTATCGCTC
TTCTGGGAAAGCGTGGAGAAGTTCAGTTGCTTGAGCACGGTACAGCGGACACGGCGGCAGAAGCCATCGCGAATCAAAACAAATTCCCCCCTGTTATGCT
GCGCTTGAAGCTTCGAGATAGCGTCACGGGCAAGTTCGTCGACGCTTCGTTGGGCTCGCTTCGTATCGAAAACATGCTGCTAGTGAATGCCGCAGATGAG
ACCAAACACTTCGTTGTTGGCGGGGGGTAATGTATCATCGTTGGTGCGTTAGTTAGAACGTCAACTCGGATATTCGTAATACTCTAATAATGCTAGCAAA
AAATCGTTATAGTCACTTTGTGTTAGAAAACCCAATGTCATCGCATCAGGAGAAGGCAGCAAGACACAGCGTCAGACTGTAACCAAGCTGCAATTAAATC
AAAAGACCACGATTGCCTAAGTTGTAATTTTCTGAGCTACTTCCACTATCGCATGGATTTTATCCATTCACCTCAGTGTCACCCGATTCAGCGCATGCTG
GTATGCGAACTGAGCATATTGCGCCGATGGCCCACCACCCCAACTGTATCGTCAAGTAGAAGAGAGCGTTTCGTCTTCATTGTCCCCGATGAGCCGAGAC
TTCTTCGGCAGTAGTGTAGGCTCTGCCTGTCCGGCTTCACGCGACATTCCCTTCCTTGAAATCGCTCCGACTTCGACGAACGCCGCCTTTCCGCGAGCCC
TCATCGACAGCCTTTGCGTCCATCAGCTCTCGGAACTCCTCCACCTCTCCACTGTGTGAAATTTGGTAAAAGTCCGCGTGCTGCAAGCCTACGTGCTCTA
AATATTGACAAGCCGACATTAGCTCGTGTGCGGCAGCCACCTCGCCGATAGACGCATTTGTTTTGGAAGTCGATGACACGCCAACTTGCACGTTTCTTGT
GGACCCCGTGCACTTGGCTGCCGAGTCCTTGGGTGTGCCTAATTGGCGTGTCGGCTCCGTGCATTCTGTTCTGCTAAAGTATTTACCCTGAAGTTCTTGG
ACCGCCACCAAATGGACTTCGGAACATGTGCCAGAACATCTTTCAGCTCATCTAAATTAAAGGGCTCGCGATCCACGCATTCACCAGAAAAGATCATTTT
CTTCTCGAAAACGGAAACGTTGCTCTGGTTTTCGGTATCGTTCCCGTTCGAAGGCACCTGATCGCCGTCTCTCGTGCTCCAGGGGACCGCGAAGTCGATG
CCTTCAGCAGTGGTCGTACGACGCATATTCGCAAACATGGCACCGCCGCCGTGCCAGTCTTGCAGAAACTCTATCGGCCACTTCGTGTTCGGCATCGACA
AAAATGGGATTATCGTATTCTGCTTCAGGCGCTTGGGAAGAGGTTTGACGCATTTGAGGTCCTTTTCAACGCCCAGCTCGTACAGCAGTCTGCCCAAAAA
CTCAGGAAACTTTACTCCATAAAAGCCTCTGCGGTGGCTTGCCAGAACGACTGCGGCTGTCACCAACCCTTCCAGTGTCATAAACCTCTGTGTGGTGTTT
TTCAAGTCGTGCGGCACTTTAATCTCTTGCCATTCTTCATGAACTGCGGATTTCAGTAGGCGAATCGTCTTTTCACCATGTCCACCTCCTGTATGAAGGC
GCTCGTCGTTCATCAGCGTTAGATGCAGCAGCATGTCTTCCTCAGGCAGTGGCAATCTGTAACGAGTACCCCATTTCTCTATGCGTTTGCCTTCGGAGGT
TTCCCCTGAACTCTCGATCAGTTTGAACAATCCTTTTCTTGTAGCACTTAGTACCAGCGTGAAAGGCTTCACCTCCTGAAGACATCCGCAGTAGCCGTCA
ATTAAATCCACACCTCCGTCTACCTCTTTGCAACTAGCACCCAAGAGCATGCAGAACTGCCCGAGTTCGAATCCAATTGCTGCTGGTGACGTCTGTTTCA
AACCACGAAACTGGCCCACCAATTCGTTCGTCATGTCCGCCAAATACTCCACTCGACTCCTTCCACTAGATCCAAATGGATTCTTCTCAATGTACTGCAG
GTCTGCAGACGCAAACAGAGGCCTACTATGCCGGAGAATCCACAGAAGCCACGGATCCAACTCCATTTCGTTCGTGATAACAAACTTTGGGAGTGACGGA
ACAACCACACACCACCGAGTTTCCCCGTGCAATGACTTAGTCCTCGGCCTTTTGCCTGTCTCCAGGTGATCGCGCGCGGAGCCACTTGTGGCACTGATCA
CCACGATAATATGAAAGGATCGAAAAACGTTCCTCATCATCCGAATGCGTTTCTTTCTCTGATCCATTTCACCTTTCCCCAGATTGTCAACACGAGTAAA
TTCGTCGAGGAAGAAGACGAAAGGCTTGCCTGTCTTCATAGCGAGAACGCGTTGTACGTCTTCTCTCGTGGCTTCCAACCCCGACAACTCATCCATTCCC
CGGAGCGCTGCACTGATAAAACCGTAGACCAGTAGACTTTGTGCTCCGAGAAAATCAGCAATCGAGCCCGCTTTCAACTTCTCCGCATCTGTCTCGATGC
AGCTGAGGAACACTTCCGACCGCTTTATAAAGGCGTCATACACAGGTTGGCGGACCTCCCCTTGGCTCCTACACAGCACGTGGAAGACGACGCACTCGCC
AGTGGCCTGGAGGTTGAACGCCATCTGCGTCTTGCCAGTGCCCGACGAGTTCTCCAGCACGACAAACGGCATCACTGCGGGCTTGGCAACCTTCAACTCG
TCATGGATCGTCTTGATGATCTTGACCAGGTCCGTTACCCCCTTCGAGTCTTTGAGCTTCTCGGCCACTGTATTATACTGGTCCAACTCGGCGGAGCCCA
TGATCCGGATAGGCTTCACCGTGGGAAGCTCGTGAAGCTTCCCACGGTGAAGCCTATCGTGAACTTCGCCGAGCCCTGCATTGATTTGGTTATCCGACAC
GACTTCGGCTGCCGACAACCCGGATATTTTGAGTCGTGAATACTCGTTATCCAGCTCTTTCATGTGGGCACTGATACCCACGCCGCCCTTATCCAGTTGC
CGTCGTCCGTCTACGTCAGGAAGAGATGAAGCTCGCCTGGGTCGCACGTGATCGTGCTCTGCTTCTTGAACAGAATCGCCGTCTTCAGGTCGTCCACCGA
GATGCCCTCATCCACTTTCACCGAGAACATGTTCCCCGCGACACTCGCGACGGCGCACCAGATAGTCACCACCACCATCTCTCCTCGAGTCAAACACTGT
GGTTACACCGGGTCGGAACGAGCAAACAAGCTTAGGAAGATAGTTGATGAATTCCCGGTTGTTCCCAAAGGGTCCCTACCGCCAGCACCCAAAATCTAAT
TAAAAGTTTTTTTTTTTCTCGTGGGTGCTGACCCTTTGGGAACAACCGGGAATTCATCAACTATCTTCCTGAGCTTGTTTGCTCGTTCCGACCCGGTGTA
ACCACAGTGTTTCCCCTCCAAACTTGGTCGCTAATTATCGATTCCCGTCACAATTGTCCCAGCAACACGCACTTTCTCGAACATCGAGCGTTAGACTTCG
AGTGCTGGTGATCTCACATCGGACTGTGACCTCCCGATGAATATTTCTCTACCTGGTTGTGCATGCAATGGTGGTGACTAATAACTTCCTCGGATGTTGG
TCAGAGGAAGACGATGTTGGAGGTCTTGTAGTCGTGGCTTCAAAACTACCGTTTGTGGGCATTTCGTTGGGCTCTCTTTGCAGCAAAAACCTGTTGCTTG
TGAATGACGCAGATCAGACCCAGCACTACGTAGTTGGCGGAAGGTATTATTTGTTCTTGTCATGAGCCAAGATTGAAGCTACCAATAATTCAGACAACTT
GCAAGAGCTTGGCACGAGGGTAGACGGTAGTTGGCATTGAAAGTACGTCCACCAAACTCAGGCATCATATATTTTATCCAGACCAGGTCCTTCTTGACCT
TCTTATTGATGCCCGCAGCCGTTCTTGAAGTCAACATGAGGTTGACGGCTTGCTCGCAGGAAATGCGTTGGCGCAAAACCGTGCAGTGGCGCATTACCAT
AGCAGCACCTTGAACGAGCTGGAAAAAAAGTATGTACCCCTAGGTGAACACTCGTGCGTAAATCACCGTATTAAGCATCAGTGGAGAGGGACAATACCGG
TAAAACAATTAATGTATTGTGCTCGTTATGAAGAAAAAGAAGAGTAAAGAACGAAAGATGTGTTGCTCACGCAATATCAGCGGAGCTCGTGTTGTCTGTA
GATTCAGATGCCGCATCGTCGCAGGATTCCTTCTTGGTAGTAGTCCTTGGTTGGTATGGACTAAAGCCAAGGCGAGAAATCCAATTTCCAACGACAACAA
TTTGCTGGGTTTTATTTTTCTTGTTCGCAAGGACGACATTCTCCACGTAAAGAGAATCCAACAGTACATCAACAAGCTCGCCAGTCGAAGCATCTTGAAG
CTGTAAGCGCAGCATACTTGGTGGGAACTTGTCTCGGTTTGCAATGGCCTCCACGGCAGTCCCTGCTGTGCCGTGGTCACGCAACGCTGCCTCGCCATGT
TTCCCACGTAAACCTATAATGATACCGCCCAGCATCATGAAGATTGAGCCGACGATCGTGACTGTCATGCATGCCCTCGGGATAGATGCTTGGATGTTCA
TTTCTTGGTAGTTCCCCGAAAAGGGTGGAGCTGCGTCGGACGTGTTTTGTTTAAGTACCACAGCGTTCTGCAAAAGAAAGTAGAGCCCTGCTGTGTACGC
TGGTTGAAGCGTGTGCTCGATGTACAGGTGGTTCTTCTCGATGTGGTTCAAATACCTGTCGACCTCACTTTTACAAAAATCACCTCCGTAGTCCTGCAAG
GTGGTGAGATACGAGTCGGTCTTCTTGAAATTGCGAGGCAGAATAATCTGCGCAGGTTTGAGCTCGTTGGCTAATTCCCCCACGTCAACTGTCGCTGCCA
ATACTTTCCACTGTGTCGACGACACAAGACGCCAGTCTGTATTAATATCAATTGGGCTAAGTAAATCCATGGGGATATTACTGTTCCCGACCAGCAGGAT
ATCACTACCGATTGAATCATCGCCTTGCTCAAGTGGAAATCGGATAGCAGAGCAGCCGTCGTCACTAGCGTACTCCGCACCATATACGTCAGAGAGGTCC
TCTGGTATCCATGAAAGACGCCCCACTGTGAGAGAGTACACCATGCGAGCATTTACCATGTCGCTCGATACGAGATAATCCTCCGAGTCTGTGCGAGTAC
TTTTTAAAAGTGAGTCCCCTTCCACCCGCTTACCAAGGCTGATGATAATCATGGACGTGTTTGAGCGCTGCTTACAAGCTTGTAGCATTCCGTCAAATCC
TTCGAGCTGATACTTGGGGTCGATAGTCAATTCTTCTTTACCGGCTTCATTCAGACAAATCGAGACAGCCTGAATGCGTGGGTAGATCGCCGCCTCTACT
GATTCTTCAACAGGTGTGCTGTCATTCAACGTAGAATTCGTAAAATTCGTAATCGTGTACATGAATTCTTGGATATCAGAAACGAGGCACGCCTGCGTAT
TGCACGTCTCCTCTGTCACGAGTTGGTAAAACGGATTCGAGCTTGACGAACTATCCTCTTGTTCTCCAAGCTTTTGCGTCGGGATCTCGATCGTGAGAGA
ATCGAACACCACAGTGTCGGACAGGTCGACATGCGAAAACTCCAGCTTGGCCAGTTCATCTGAGGTGCTAGCATTGTCTGCTCTCGTGAAGTAGTCGACA
ATAACCCCATGCATGGTACTTACAAACGTCGCATTCGCGGATGCCCCCGTAGTCAAGTTTAAGTAGTCTGCCAAGACCACAGGATTGCTTGGAGGGTCAG
TAGAATCCGAAGCAAACCCCTTCCAGAATGTCGTTTCCATGCTCCACCACCCCAAAACCTCGTTGCCCATTACCAGTGCGTACGCGGCAAGGTTGGTGGC
GTTGCCTACACTCATCGGAAGCCCCTCGTCCAGTGGAAGGTCTGAAGCAGCAGCATTCATCGGCATGCTTAAAGTACCTGTTGGCTCCACTGCTTTGGTA
AGAAGGCGCTGCTGCCACGATCGTGAAGGAACCCCGTAGTAAGCGAAAATTTTCTTGAACGGATTTGAGTACAAGCTGTTAGTATTGGGGCACCAAGCTG
GAACCTCCTCCATTCCCAGAAAGAAGTTGCGCAAAATCGTGTTGAGCACGCTGTTACCAGGCGTGTCTTCACGGAAGCTGGTGTTCCTTGTCGTCATCAA
AAACTTGTTGGCATCCAGATCCTGGTCGTTGAATCTGCGTAGGCCTTCGTAATCGTCATTGGTAAGGTCCGCCGACGTAATGCGCGCATGAGTGCGCCCG
GAGACCACTTGTACGTTTAGCGAACTGAAGCCATTATTCATTATTCATCATATAGCCCACCACGCCAATCACAGCCATTACGAGGTATCTGCGTCGATTC
TCCTGATGGATACTAAACTCTGTAAAAACGCACACGACCACCATGGACACTACCATGGTCAGGAACACATCAAGTGGCTTCATCAGCAGAGCGCTCAGAG
TACCGGAGATTGAGTTGTACTTGTCCAGCATTCGCTTCTGCTCCGCTGCATCCATATCGATCGAACGAAACTTGCCCACTCGCACCCCGTCGCCACGAAA
AGGAAGCATCACGCACACAAGTACAACACCCAACATCACGGAGATAATCACAACGCGAGAGCGGTGGATGCCAATGTTCAAGGTGTACTCCGAAGAGGAC
TTCCCATCCACATGTTCTTCAGTCTCGCTCGTCCAGTCCGTCTCAGTGACCGAGCTAGTCTGCAATTCTTCATTGGGCGTCATCGACGCGACTTCCGCCC
TGCAAAATGAACAATGAGGCCCCGAACGACAACTGTTGGGTACAAGACAAGAGTTATGGATACGAATGATTTAACTTCAGCACAACTGCAATGGCTACGA
TAGTCCTATTCTGGCTCTAAATCTTTGTAACGTCGTCAAGGGAGACCCGGATTGAAGACCTTTCGGCAGGATGCTCGATCTGAAACCCTCGGTGGCATCG
CCCGCAAAAAACTCAACGGAGTTCCTGTTTCAACAAGAAACGCTCAGGAATCGCTGCATTATCTGTAACGTTGAATTCCTGCAAGAACTATTATCACTCG
AACCCACGGCTCGTCTTATCTTAACATTCGCGCGTCCAGGAACTTCCTGGACGCGTGTTCCTGGCGGGAATGGTCGCTGACAATTCAAGAGACAACTTTG
CTCTTCGAACGCCCGCTGGAAGTCCTGGCGAAGGCGTTGCCGCAATACCACGCCTCGTTCACAGTAGGGCTCGTCATATGATGCCGCATACCAACAGAAT
TGTTCATCCCTCTCATACAACCACTATCAACATGTCCTCAACACTACTCCTCACGCTAGCAATTATTCTTGCCCTATGGCCTTGCTCTGCTGTAAGTACA
GATTGAGGGCAGCACTGGCCCGACTCTACTAAGTTCTCTAATAGCTTCTCGAGAAACGTGAAAAACATGTCAAATCTCAAGAATTATAGACAGAAGTAAA
ATAGGTAGTCCTGAGCGTGTTGTCGGGGCCAGACAATCATAGTTTCACGAACGCTCGTCAACCTGGCGCTTGTGCGGAGTTCACTATGCTCCCGCTGAGT
CCAACCTCGAAATCGTGGGGGTGTTAGCCGACGGGGAAACGCTTTTGCTAATCGCAAACTGCTGGGTCTTGTCCTCCTTCTTTGCAAGCACCACGCTGTC
AACACACAGCGAGTCAAATGCAGCATCAGCAGTCTTGCCGGTCGACCTATTCCTCAACTGAAGCCGCAGCAAAGATGGAGGGTACTTCTCCGTATTATCC
AAAGCTTCAGCTGCGACGGTCGCACTGTCCTGTTTAGCTAATGAATCCTCTCCACGCTTACTAAGGACTGCGATGGCGACACCTCCCAGCACCATGATGA
AGCAGCCGATGAACGCGAAAATCATGCTGGTTTTTGGAATGGACGCCCAAATGTGCATATCCAGGATGTTCCCTGAAAACTCGAGCGACGGGCCGTCACT
GCCATTGATTTGCTTGAGCACCACAGCATTCTGGAAAATGAAGTAGAGTCCCGCCGTGTACGCTGGCTGGAGACTATGCTCGATGTACAAGTGGTTCTTC
TCGATCTGGTTCAGATGTCGGTCGATATACACTAGGCAATAGTCAGAGTCGATTTTGTATGCAGTGGACGATCCATCGGTGGTGTTGAAATTGCGCGGCA
AGACAATCAGAGACGGCTTGGATTCAACTTCGAGGGCCGCTCGGGGTTCATCTACCGTGGTCGCCAGCATTTTCCACTGTGAATCACTGATAGGAAACCA
ATTCCAGTTCAGATTTATCGGGCTTAGCAAACTCATTGGAATTCCACTTTCACTCACCAGCAAGTGGTCGTTCAGCAAGGTACCATTATTTCCCAGCGGA
AATCGAATTCCTCTGCACCCATCGCCAGTCTTGCACTCGGCGTTGTACGTCTCTGAAAAGTTTTCCGGTCTCCACGCCAGACGCCCCACAGTAAGCGAGT
ACACCATGCGAGCATTCTCGACTGTGTTGCTTGAACTCACCAACGAGTCCCCTTCAATACGCTTCCCCAGACTAACAACCATCATGGACGTAGTCGAGCG
CCGCGTACACGACTGCAGAATCTGCTCAAGACCCGAATAGTCGTTGTCCACAACGAGGGTCTCTTCTCCTTGGTCGTTCAAACAAATGGCTAGTGCTTGT
ACGCGAGGGTGGATCGCCGTTGTGTTCCCATCCGCCTTGTACTCTTCGTTGTCCGCCAACAGACACGCCTTCGTGTTGCATGCGTAAGAGTACAGGGGCC
AATAGAATGGATTCGTGCTTGACGAGTTGTCTCTCTGTGTACCGTACGTTCGGGTCGGAATTTCAATCGTCAGAGCATCAAAAACGATAGTTTCGGTCAA
GTTTACACGCGTGAACTCCACTTTCGCCAACTCATCCGAAGTCCTGGAGAGCTCCGCTTTATCGTAGTAGTCAATGATTACCTGGCGGGCAGTAGAGGCG
AAGTTCGCGTTGCCAGTCGAGCGAGTTGTCAAGTTGAAATAATCTGCCAGAACAACTTTCCCCGTCGCGTTGGCGTGACTGAAACTACCCCAAGCCTCGT
CCTCTTTCGTCCACCACCCAAGAAACGTGTTGCTCACGACCAGCGAGTACACCACCAGGTTTGTTGCAATG