Description :
From Genome Similarity Track
Location :
Scaffold_322:10751- 13511
Transcript NameFunction/comments
Physo_144912reverse transcriptase

Sequence
2760 bases(100 bases per row)
ACAACTTCAAAAGGGCGCCTCGGTTCGATGTTCCCAGGGGAAGGCTCTGGATTCTGAGGGCGCCCCTTGCCGCTGGCGCAATCCACACACTCTTTGACGA
AACCTTCCACGTCAGCGTACATGCCGTGCCAGTAGAACTCAGAGCGCAGCTTCTCGTACGTCCTCGTGATCCCCTGGTGCCCACCCTGAAAATCTTCGTG
AGCGTAATGCAGGATATCCGGCTGCATAGCCTTCGGCACCACGAGTCTGAGTTCGTCAAGCATGTCTCGGGGTCGATCTCTGGTAGACCGACTCAAGCGG
TACAGGACTTCTCTGGAATCCAACACGAAATCATCAGCGACCTTCGCGAGTTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGTGTCGCCCTTCAGGAAAT
CCTTGAGTTGCAGCAGGTGATCATCTTTGTCCTGGTGCACTTTGATGCGTCGCCAGCGTTCAGCCTGGTATTCCAGAGGTCCCATGGGTTCGCTTTGGGC
TTCAATCTCCTGAGTTCGCGCTCGAGTCATTACTGCAAACACTCTGGCCGCCACAGGCAACGGAGCGCATTCAGGTCCAGGGATACCCAGAGTTTCGACA
CCCTGAGAATCACTCCCCTGAATTCCAACGTTCAATGACATCTTTGGCTTTACCAACTTCTCGTGAATCTTGGACACTAACTGCAGATGTGTTCGTTCAT
CAGCGTCCTCCACCTTCCAGGATTCGCCAAGCGCGAGGGCCTTAGACGTCAGGTAGTCTGCTGCCTGGTTGAACTCTCGCTTGACATGCACCAGCCGCAC
AGACTTGAACTTCGTCTTCAGCACTTCATACTCGGCCATCTTCCTCTGGAGATTTGGCTGATTGCAGTTGATGAGACCCTGGGCTTGCTGGATGGCAATC
CTGGAGTCCCCAACCACAACGATATCCTGAATTCCACGCTCAATCGCCAGAGTGAGTCCCTTCAGAAGTCCATGATACGCAGCGTCATTCACAGTCACGT
CCTCCAGGATGAATCCCTGGGCATCCAGGATTTCCCACCCGGGGACATGCCACAGAATGCAGCCGCAGCTCCCTTGTCGCGTGGAAGTCTTAGCGGCGCC
ATCGAAACTCAGAATACACCCCTCGTAGTCCGCTTCCAGCATTTCCATACTGATAGGCACTGGAGGTTTGACGCGCCCCTTGGCTGGGATCAGGTTTTCA
GCGATCTCATCCAAGTGTTCTCTGGGGGGTAATACCCGCACCCAGAATTGCAGCTAAGCCGTCTTCATCTCGTTGAACTCTGCGTATCTCTAGGTTCCAG
TGGGACAACTTCAGACCCCACTTCACCGTTCGACCGTCTGCCGACTACGAAGTCAGCAACCACTTCACCACAGAGTATCGCGTGTAGACAACGATCTTAG
GGCTGCCTTCAACCAGAGTGCGAAACACCTCCAGGACTCTCAGGATAGCAATCACCTCCTTCTCCGCGATGTGATACCGCAGCTCAGCGTAATTCAGGAC
GCGACCTGTGAATCGAACCGGATGCACAACCCCGTCGTACTCCTGGCCCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAATAATCACGAAGGGC
CTTGAACGATCAGGATGTCTGAGTAACGGAGCCGAAACAATCTTGCGCTTCAGGATTTCAAAGGCTTCCTGGGTTCTCGACAGGTCTCTCCTGAATTTCA
CTTGTTCCTCAGTCAGCTCGTATAGGACGGCCGCGATCACGGGTAGATCTTCAATGAACTTGTTGTAGTAATTCAGACTCCCCATGAAACTCTGGACGCC
TTTCAGTGTCGTCGGGAACGGCAAGTCTTGGACTCCCTTCGCGATTTTAGGGGTCGCCCGGACACCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATG
GACAACTTCCCGAATTCACTCTTGGGAAGACTCACAGAGATATTCCAGTAACGTAGTCGGAAGAGCAGCGCGTTCAGATCCTGGCACAGCTGCTCCCAAG
TAGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAGGACAGGGCCCATCTGAGAGGGAGCCGGGATGTTACGCTGAAAAACAGTGATCTC
ATCCGTCAACACTGAAAGTCGCGGTGCATTTTCACCTGAAACTCTGGGTTCCCCAGCGTTCAACCCAAAAAAGTCCATCCTGACCCACTGGTAGTGCCCA
TAGGGACAGACGAAGGTAGAGATCAACTTGGCTCTCTCGGACATCTTGATAGCCCAGAAACCACTCGCCATGTCCAAGCTCATAAACCACATCGCCGACT
CAAAGCCGATCAAAAGATCATCAATAAGCGGCAGCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGATAGTCGATGCACATCCGGATGTCGAC
GCCATTCTTCTTGAGGACGATCACGATTGGAGATGCCCAGGGGGACGTAGAAGTCTCGAGCAGCCCGTTCTCCAGAAGCTTCTTCAGAAGTTCATACACC
TTGGTCCACAGGTGTGGTGCAATGGACCTTGGACGCTGGGCAACAGGTTTAGCGTCGCCTACATCCAGGTCACAAACCACTCCACGGGCAGGTGGGGGAG
CTGCATTGCCGTCTCCCAAGAAGATCTTCCGATGATATTCCAGAATTCGCCTCACTTGGTCTTCCATCTCGGGCGTCGTTTTCCCAGGGACTCCAACATC
TGCCTCCTCGATCTTGCACTCAGGGGTCAAGTCACGCATCTCAGGAAGCATAACCAACTG