Description :
From Genome Similarity Track
Location :
Scaffold_425:10750- 11905
Sequence
1155 bases(100 bases per row)
GCTTAGGCGCCAGGGTGGAGGCCGAGCCAGCCGGGACTCGGCTCGCCCTGCACCTCGCCGAAGTAGAGCGCGAAGGTCTGCTTCCAGTGCTCGACGGCCG
CGCGGTCCTCCATGAAGGTCGGGAAGAGGTCGGTCGAGCCCTCCTCGTACTCCCACAGGTGCTTGTAGCCGGCGGGAGCGTCGATGTCGGTGCGCACCGA
CATGCCCGAGAGCATCGTCGTCTGGATCTCGGTCGAGAGGATCCAGTTGAGGAAGAGCTTGGCGGCCGCAGGGTTCTTGGCGTCCTTGAGGATCGCGATG
TGCTGACCCCACGTCAGGTACTGCGTGCCGTTGCCGGCCACGAACGTGATGTTGCTCGTGTTGCTCGGGTAGAAGCTGCCCGGCGCGGCCACACCGATGA
GCTTGTCGCCGCTGTCGACGGCGTCGCCCGGCGTGTTGGAGCCGCGCTTGAACTGCAAGTCCTGCGCGGCGAGCTGCGCGACCCAGTCCCAGCCGTACTT
CTCCACATACCGAGTGTACACGAACAGCGCGGCGTCGTCGTCGTGCGGGTACGTCGAGGCGATGTGTCCGGCATACTGAGGGTCGATGAGGTCCTCGGCG
GACTCGGGAGCATCCAGCCCCGCGGCCGCGAGCCGCTNNNNNNNNNNGAAGAAGCTGAAGGTGCCGACCATGTGCGACATCCACGTGCCGTTCTCCGACT
TGAAGTCGTCATAGATCTTGGAGAAACCCGCGGGCTTGTACGCGAGCAGCTTGCCCTCCTGGTCCCAGCGAGGGAAGTTCTGCACTGTCTGGAGCGCTGT
GATGTCCGGCACGAGCGTGTCGGTGTCGAGCTGGTTGTCGATGCGCACGTCGTGGTACTTGGAGTAGTCGACGACGATCGTGAAGTTGATCTCCGGGTAC
GCCGCGACGAAGGCGTCATGGACCGCCGTCTGCTGCGACTGCAAGTCGCCGCCCGCGTAGTACACGAGGTTGCCACCTTCGGCGATGGCGTCCTCGTAGA
GCTCGTCGAGCGTCTTAGTCTCTTCCTCGACGTCCTCCGCTCGCACGGTCGCGGCAACGAGCGCCGTCGCGGCGAGGAGCACGGTCAGCTTCTTCCCGAA
GATCTTCATGGCTCGAGCAGTCGAATGCGCTTGGCAGAGAGAATTGGAAAGTGAG