Description :
From Genome Similarity Track
Location :
Scaffold_125:107492- 109602
Transcript NameFunction/comments
g14824.t1hypothetical protein

Sequence
2110 bases(100 bases per row)
GGCAGCCCTGTGGAATCTCCTGTCTGCCCAGTCAGGCTGACCATCCGCGTGCTGTTTCTATGACGGAAGCTGGGGCTGGGCGCCGCCTGCAGGTGAGCTT
CATCTCCAAGTATGACTCGCACCACCTTTTCGATCGCGTCGACGAGCTCCAGGGGATTCAATTGCTGAACGGAAGCTACGCCCAGCAGCTGCGCGATATG
CAGGAGTCCCAGCTGAAGCTTCTCGTGAAGTACTCGCAGCCGTGTGGCTCGATCCTTCTTCTTTTGCTTGACGGCATTTGCCTCATTCAACTGCTTCTCC
AGCATCTTCGCGTTGACGCTTGTTTTGGAAGCTGCAGCATCGTCGTCCCCGTTCGCAGTGGCCGCGTCGTCCTCTAAGGAGCCATCCACTTTTCCACTAG
AGCTGCCACTCAGCTTGAGATTCACAAACTGAGTCTGAAGGAGCGCCAGCTTCTCGCGATACTCGAGCACTCGCTGCTCTGCTTGTTTCTCCTCCTCTTC
CAACTGAACTGAGTGATCGAGCTGGTTTTGCCAGCATAGCAGTGCTTCCTCGGGCTTGTTGATGCCGACTTGCCGAAGCGCGCCCAATATCCCGTCGTCT
TTGTAGGCACTTCCCACGTACAGCTGCAAGTTCTCGGTATTCTTTTGCCGTGCCAATGACGTCTCCTTCATATGGATCAACTTGTCCTTTGCTCGCACGA
AGTTTGCGTCTGGGGCGGTTTGCGTCGACTCGTCTGTTGAAGAGCTGGTGCTAATAACATGGCTAACAAAGTCCGAAATGCCTGAGCTGGGAAGCAGGGA
GCTCTTCTTCTGTGGGGAGGCAGCTGCAGCTTTTGTTGCAACTTGCCCGCCAGCTTTCGCGGAAAGACTGGCGTAGTACAGCCGACGGTCGAGCTCTTGA
CGCCATCGTAGTCGTGAAAGTGCTTCCTGGTGAATGGAGGTCTTGTCTTGTGTCACCTGCACAAGCTTCGGCACATCGAGACTAGCAAGCCGCTTCTCGT
ACGACACGACTTGGGCCTTTTGCTGCAGATCCACTATCTCGCGCTTCAGTTTGGCGACAGTAGCTTCAGCAGTTTCGATTGTCTTTGGATCCCGGGCAGG
ATTCAGTTCGCAGTGGCGTAGGATTAACTTGTAGTAGTCACTGCGCAGACGTCCAAGCGCAGCTTCATCGTTCACGTTGCGGATGTTTTCTAGCAGTTCA
TCAATATGTGAAGCGCTCTGACCCGCTGCAGTGATTTCCGCCTTGGAATCCTGGACACGCGATTCGACCGCTCGAAGCGCTTCGCCCTTCTCGCGTGCAA
CGAATTTCATCCGGTCGTACTTCATTCGAAGCTCCATTAGTTGACTCTATAGGCATTAGCAAAGGAACGAATGTTAGACAACCAGCAGCGATAAAATAAT
AAGCGAATAAGTAGTTCCGAAGACGAACCTCCAGCTTTGAGACGGAGCCCAACGAGCCTTCGCTATTCTCCGCTGACAGGAACTCCAGTGCTCCCATTTC
GTTGTCTGCAACACTTTCACTAACCGGGGGAGGTACAACCTTGTGTGGATGCCGACGCTTTGTAGGAACGAGAGGCTTTCTCGGATTGCCAATACCCTTG
GGTAGAACAACACCTGCCGGGTTATGGTGCGATTTCTTCGCAGCTCCTTTCCTGATAGATGACGGAGATGACAACTTTCCAGGACTGTTTGATTCGGTGC
CGACAGCCTCATCTCGAGTACCAGGAGTAGACTCACCATTCACAGGGTTTCGTCCCGAGGCAGCATTACGAAACACTCGACTCTCGAATGCGGTGCCAAT
CAGCGGAAATTGAGTCCAAAGCCACCGTCGAACATAGTAGCCATCATCTTGATGAATCACCAGAGCATCAATCTCCTTGTGGACTCGTTCCGCCTCACTC
TCCGATAGACCTGCAGTCGAAAAGCTGCCTAAACTACTAAGGAACTCCTGCAATAGAGGTGGTTTGGGTCGATTTAGAACAAGATTGACTACACGAGTTT
CATCAACCTTTTGCCACGCTCGGAGGAAGTCAGTGATGGTGAGGAAAATTGACAGCAATTGTTCTGCACTTGGAGCTTCCTGGGCAATGTACTCGTCTAG
CGAGCGAATG