Description :
From Genome Similarity Track
Location :
Scaffold_109:10748- 13654
Transcript NameFunction/comments
Phyag_g2170hypothetical protein PHYSODRAFT_474772
Phyag_g2171hypothetical protein PHYSODRAFT_310097
Phyag_g2172hypothetical protein PHYSODRAFT_358780

Sequence
2906 bases(100 bases per row)
gacgccTACACGTTCGTGTACTCTTTGGGCGCGCATCGGTTCGATGAACTGCTGTACAGCCTCACGGAGGAAGCTATTCGAGGCCTCGTGCACTCGGTTC
GTCACGACCAGGTGCACGATCTTCGAGAGGAGTTCGCTATGGGCATGAAGACGGATCTGAACGCCAAGCTAAAGTTCTATGGTGTTTTTATCCATAACGT
CAAGGTGACCAATGTGGACTTGCCCCAGGCGCTGTCCAGGACGCTGGAGGAAACGACAGCATTCAAGACGCGcatggaggagcaggagaagaaccACGAG
AACCAGATGCGCATTCTGCTCAACCAAGAGACGCAAAAACTCACTGCACTTGAAAAGAACAATGAACGTGCGATCCAGGACTTGCAGGCTGAGAGTGTCC
GTGCAGCTATTATTCGTGATGAGAGGCGAACGATTGCCGAAGCGAAGGCGCAGGTCACTATCGCTGAACATGTTTCGAGGAACGAGAACAAGATTAAGGC
TGCAGAGGGTTATAAGGCCGATGCGGTCGCTAGTGCGACCGCCAAGACGGTGAAGCGCAAAGCGCTGCCGACGGTGGAGCTCAATAACCTCAAGGTGGAC
TTTGACCAGTTCGTAAATGTCGCCAAGGTGCAAGGAGACGCTCGGATCCAAGctgcggagaaggaggcggcgaaGATTTTGGCGAATGCCGAGGCGGAAG
GGAACTCCGCGGCGTTCTTGAAGGCCAAACGCGACTATGACTACAATGAAAAGAAGATTCGCATGGAGACGGCTCTGTTGGAAACCGTCCCGCTTGTTGT
CAGCGGCAAGAATGGCGACCGCCTTATCGAGGGCACGCTGTTGCAGACAATTCAACCAGCGAAGTAAGCTGAAGCGCTCACTCACCCACCGGAAGGTATG
AAGATGCTACCTAATACGTCGTCAGTGTTTGTCATTTCGTTTGATCAAGGAGGCAATCATGGTCACAAATTTATCAGGGAGCAACAGGAGTTTCCACAAC
CTTTTTTCCACGTTGGTCAGGTAAACAATACTAGTacatttgctgcagctacatATGAACACTTGGGTTCTTAGACAAATTGTCTGAATGGCAGCAGTGC
TGTCGAATCATGTCGGCAATTCTCTTGTAGAGTTCCGGGTGACGATCTCCAGGCGGAAAACGGTGTCCGTATTCGTGAATGTGCACATACTTGCTCAAAG
CCGACCCTGGCGGGTTGTCAGCGTACAACTCGGCGTGCTCGCAGCAGGTGCGGTAATACTGATCCTTCTTGCCAATGAGGTGAATTGAAGGGATCGGCAC
GCGCTTGGGAGAACCGTCCGCGTGTTCGAACATCGGACGCAAACCAACGTCTCGTACTCGGGTTCCCGAGCAAATGAGGCAGCATTTCCAGTGACGCTCG
TTGCGTTGGTACAGGTACCACATCGACAAGGCAGTGAGCATTTGCCCACCTTGCGAAAACCCGACGGCGGCGTCGAATGGACCATGCTCTTGCAATTGCT
TGTCAACGTGCTCCACAACACGATCGAACCCGACGTATTTGTGATACCAACCATTGTCACTGCCGTTGGGCTTGCGCTCCAGCTTGGTGATATGTCCCCA
CTCGTAGAACGGTGCGTGGTCTTGGTACAGCCGCTCGATCACCTCGTCAGCGGGTCCACGAGCCTCAAACGGGGCTGTAGCAAACACGAACTCCGCGTGG
GGAGCCATGGCGCGACGCAGAGCCCGCGTCTGATCCTGCATCACCTTCACGTTGGTGCGATACCCGTGGAGACACAGAACGCGAAGCTTCTTCGTAGCGA
TTGCCATCGTTTTGAGGACTGCCTTCTACCTTGTCGCCAAATTACGAAGTGAATGAAGCCTCCACATCTCCCCATCCGACCATGCGTGTACAGTACTCAA
CTAAACTTCAACGCTATCCTGATGAGTGGATCGACTCAATACACGACTCGATGCGTACATTGGTACAAGTTTACTCTCCACATCTACTTCTACTGCTCTA
CTCGCAATGCTGGCGAATGATGCGAGCCACGTCTTCGTAGAGCTGTTCGTGTCTCTCTCCACTTGGGAACCGATGACCCGTGTCATGCTCGAACACGAAC
TTATCGCGTGCTGCCCCCTCAGGGTGGTCCTCGTACATGTCGACCAGTTCGTAGCAACCGCTACGCCACTTGTCCGTCTTGCCGATGATGTGGATCGACG
GCATCGGCACCAACCGCCGACTCCCATCCGGATTCTCGAACAGCGGccgcagcgcagcgccacgCACTCGAGGGCCGCAGACACTcacgcagcatttcca
ccaGCGCTTATTGTGGTGATGCAAATGCCACATCGTCAGCGCTGTTAGTGTCTGCGCGCCTTGCGAGAAGCCCACGACTGCGTCAATGGGCCCGAGCTTC
GGTAGCTGTTCGTCCATGTACTTGACCGTCGTGTCCCAGTCCACGTAGTCGTGGTACCAGCCGCCGTCCAGATACTCGATCTCCTGCGTCTCCGGGTCTT
GTCTGTGCGGCCGCTCGCGCTCCACGAAGCTACCCCACTCGTAGAAGGGCTTGTGCTCAGCGTAGAGCTTCTCGATCACATCGTCCGAAGGTCCGCGAGC
CTCAATGGGTCCGTTCAGGAACACAAAATCGGCGTGTggcgccagcgccttgcgcAAACCACGCGTCTGGTCCTCCATGATCTTGGCATTGGTGCGATAC
CCGTGCATGCACAGCACGCGGAGCTTCCTGGCCACACCCATGGCGAATCGGAGACTGGATGCCTGTTAACTGTTGACGCAAACTTCAACTAGCAGTTATG
TAGTGTACACTAAATGATGCGAGACGCACACCAAATGGTGTTCAGAGCCGCGTATCCACCGAATTGTCGTCTGATTGGTCAATATTCCGAGGGGCGGAGT
AATACA