Description :
From Genome Similarity Track
Location :
contig_98:10745- 11872
Transcript NameFunction/comments
g12850.t1hypothetical protein

Sequence
1127 bases(100 bases per row)
CGCGTCCAGAAATTGTTAAAGTGTGAAAAGCAAGGACTCGCGTCCAGAAATTGTTAAAGTGTGAAAAGTCCTCGAAAACAGAATTTTATCAAGTGCTCGG
GTCACTTCGGCATGTAGCAGTGTGCCTTCGTACGGCGACGCCTTTTTATCAACGACTGCAAACTCAGTGCAATGCTGTTCCTCGATTTGATAGCGTTCGT
TTGTCAGAAGGATCAACAGAAGATCTGGTGTGGTTCAACCAAATACTGGACCATGGGTGCCTTGCGGAGCTACCATTAGCGATGTTCGGGGAGATGCCTA
CGCCGCACGTCGAACTGTACATGGACGCCTCCAATCTTGGCCTCGCCATCTTTGATCCGTCGTCGAACACGTTCATCCAGATCAAATTTGATAAACATGA
ACTGATGTGGATCGATCAAACTGCTGATAGCAACACGGACTTTTCGATCTATGTAAGAGAGCATTTGTGCATTGCTCTCGCACTATGGTCATGGGGAGCG
AAGTGGAATACGCAAGCCGCCGGCGGGCTAGTGCACGTAAAATGTTGGAGCGATAATATGTCAGTCGTGACGTGGAGCAACAAATTGCAAGCTTCGAATT
CCCTTGGCCAAGAAATCAACAGGGCCATCGGACTCGCCGAGGATTACTTTAATTTACTCGTGTCGGCTGATCACCTACCAGGATCGACAAATATCATGGC
TGATGCGGCCTCATGTGCTTGGACCGAGCCGTATCTAACTCGATAGACTGACTTCTCATTAATCTGGTCAGAGACTTCAGCTCCGCCGGAATGCAGAAAA
CGCTACACAGGGTTCTCCAGCAGCTTCAGTCCCGTTCATTGGCCACGACATGGGCAGCAAAGTATAACGGCACCTGGAAGCAATGGTACGAGTGGTGCGA
GTGGCTTGGGTTCTCGCAGTGGCTTCCAGAAAACCCGCGACAGCACTCGTACAAACTGGACTTATTCGCAACATACTGCTGGTACTACGGATGGAATCAG
TCCGCCTCCGGAAACGCTGCCGGCACCGTGCTCTCCAAGATCAGCCAGGTTTCGTGGCATCATCGGAGGTCACTTGGTTATAGTGTCGGCCTTCTCCCGG
GACACCAGCTCGCCATCACAGGGATGC