Description :
From Genome Similarity Track
Location :
Scaffold_777:10744- 13029
Transcript NameFunction/comments
Phyta_totarag10677hypothetical protein

Sequence
2285 bases(100 bases per row)
CTGTTTGTTGAGGAGGCCATTCGGCAGCGCATTTTGGCTCGCTTTGCTCTTCCGATCAACGGCGACGACTCTGACGATGAATTTGCCACGCAGTCCCCCA
AGTACGATCGGTGCTTACGAGTACAAGGACTTGACCGCGTGCTACGAATGTGCAACTTCGCACCAATCGAGTTGAACGTCTTTGGGAGACTGTCGGAGAT
CACGTCATGGCCAACTGGAACGTGGGCCGAGGCAAGAGAGCACGAGCTCTCCCAAAGACATCTGTTCATGACATTAGGCACCCTcaagcactgcagcagt
tgggACACTGTCTGTTCGATGCTTGACATGGATCCCTCTCCATtccagaagaagatcgagaagTTTCTCATCATGCTAGAGCCGTTCTTGTACGAAACCT
TCGTCGTGAAAAAATAAAAGCTCTGGACGATGAAGCAGTTGACGGCCACCGGCAACGCTTTCACGAACATTCCGTGTGCTCGGTATGCGACCGGGCTTAG
CAAGCGAGTTCCGCTCGATacagccgaagaagaaggcgcttTGCTCCGCCACTTAGCCTGGATAAAACCCGAGAAAACGATCGCATCTCTCACGATCGAG
TGATCGTGAAAATTCTTCGGGAGACTAAAGACATTGTGGGGCGTGTGCGCGCACAAGTGAGATTGGGATAACAAGTCCTACAACATGTTCTTCAGGGCGT
GCTTAGCTTTGACGAACTACAGCGTCAGCTTATGCCCTCTGCGtcacgaagatggagacaacTTCCTTCGTTATGAAGCGCGCCTTAAGCAGATTGGCGC
TGAAACCGAGgcggtgaagacgaagaagcttgaGGACTACAGAGACAACAGGCGGCCGAGATTGGAGCTGTGTACGCGTGCTGCAATTTGGCCCAGGACC
AGTGCTAACCGTCGGACCAGCATTAGTGCAAGCCAGATCGGTAGTCCGTGCAGTGCTGTGTACGGATCGTCGTGATTACTGGGACTTCTGACTTTCCTCT
TTTTTATATCATGTACACTTGCTCAGTATGGTAGTAAATGCGCAGTACGGCCTCTGAATTCCTAACTCGATCGACCATTTCCCAATACAGTTCGTACTCT
CTTCATTGCACATATAACCGAGCATCTGTTTGTTGCATTTCGAAAACATTAGCCTATGTTATCGTTAGCTTGCATCTCATCGGGTACTCCATAATTGAAT
TTGAGCCCTACTGACGAGGCAACCGAAGAGAAGTAATACACCAGAATTTAGATTTGCATTTTGTATGGAACAAAAAATACGTTTTTCATTTGACACGAGG
TTTTTCGTTTGTATGGAATTTTGGGGTGTCCGGATGCACAAATGTTTTACAGTAGTGTACTATATTGATATCCAGATCTTCCTGGGCAACATACGGCATT
AGTACCTTTGAAATGGTACAATCCTTGATAGTGATACCTCTCGATAGTAAAAAATGACCTCTTCCCGGGGCTATCTACGGAGAGGATGGTCTGTACTGTT
TTGTATTAATCTCTCACAGCTTTTGTGTTTTGTGACACTAAGCGACAACCATAATGCGAACACTTTGCCACGATTCAGGCACCTTGATTGTCCAGACCAC
TCCAGAGCCTCTGCTTCACGTGTGCAGGAATACAGCCTGATTTGGGATGGTACAGACAACAACGCCTTTCAGACTATTGTTTTTCCACTATAATATAAAT
GGAGATTCGTAAAACGTGAAAACGTAGTGTCTTGAGTGTTGGTTATTGTATACTTAAAGTAGTACTAACgttagtacatgtaaaaccCCCAGATCCGACG
TAATTTGTCCTTGCTTGTTTGAGCTCTAAAAAAAAGGTGAGAATGGCGCTACATGTAGGTGCTTCATCTATCTAGAAGCCTAGCGCTTGACAGCTAAGTT
TAAAGATGAGCATATGAGAATGCTTTGGGGGCATACTCGTGGGGATcctaatacatgtatgaagATGGCGATCGTGGTGTGACTTTTTTTACAGTGAATC
CCCAGGTAAAGCAGCTTTGTTGGTTCAGTTTAGGGCAACCTGGATAGAAGAGAgttgtgttgttgttgtacaaGAACTGTTGTGGGCTTTGTAGCCGCCa
tacctgtacatgtagcagcttGAAAATGTGGCGGATGTATAAtatgtattacatgtataatatACAGTACCAAGCACTTAATGATTATAGACCGTTTTAG
ATTGAAAAACATGGGTACATGGTACGATATCGATCCACCGTCTTGGTAGGTAGTAAAATATATGAGGTAAACATGATAACTGTCA