Description :
From Genome Similarity Track
Location :
contig_98:10744- 11871
Sequence
1127 bases(100 bases per row)
AAGCAAGGACTCGCGTCCAGAAATTGTTAAAGTGTGAAAAGTCCTCGAAAACAGAATTTTATCAAGTGCTCGGGTCACTTCGGCATGTAGCAGTGTGCCT
TCGTACGGCGAAGCCTTTTTATCAATGACTGCAAACTCAGTGCAATGCTGTTCCTCGATTTGATAGCGTTCGTTTGTCAGAGGGATCAACAGAAGATCTG
GTGTGGTTCAACCAAATACTGGACCATGGGTGCCTTGCGGAGCTACCATTAGCGATGTTCGGGGAGATGCCTACGCCGCACGTCGAGCTGTACATGGACG
CCTCCAATCTTGGCCTCGCCATCCTTGATCCGTCGTCGAACACGTTCATCCAGATCAAATTTGATAAACATGAACTGATGTGGATCGATCAAACTGCTGA
TAGCAACACGGACTTTTCGATCAATGTAAGAGAGCATTTGTGCATTGCTCTCACACTATGATCATGGGGAGCGAAGTGGAATACGCAAGCCGCCGGCGGG
CTAGTGCACGTAAAATGCTGGAGCGATAATATGTCAGTCGTGACGTGGAGCAACAAATTGCAAGCTTCGAATTCCCTTGGCCAAGAAATCAACAGGGCCA
TCGGACTCGCCGAGGATTACTTTAATTTACTCGTGTCGGCTGATCACCTACCAGGATCGACAAATATCATGGCTGATGCGGCCTCATGTGCTTGGACCGA
GCCGTATCTAACTCGATAGACTGACTTCTCATTAATCTGGTCAGAGACTTCAGCTCCGCCGGAATGCAGAAAACGCTACACAGGGTTCTCCAGCAGCTTC
AGTCCCGTTCATTGGCCACGACATGGGCAGCAAAGTATAACGGCACCTGGAAGCAATGGTACGAGTGGTGCGAGTGGCTTGGGTTCTCGCAGTGGCTTCC
AGAAAACCCGCGACAGCACTCGTACAAACTGGACTTATTCGCAACATACTGCTGGTACTACGGATGGAATCAGTCCGCCTCCGGAAACGCTGCCGGCACC
GTGCTCTCCAAGATCAGCCAGGTTTCGTGGCATCATCGGAGGTCACTTGGTTATAGTGTCGGCCTTCTCCCGGGACACCAGCTCGCCATCACAGGGATGC
GACGCTCCGACCCACCCAACCTACCCG