Description :
From Genome Similarity Track
Location :
Scaffold_257:10742- 11888
Transcript NameFunction/comments
Hyaar_Emoy2813246M96 mating-specific protein family

Sequence
1146 bases(100 bases per row)
CGTCGTCATTTCGTAGCATCCCCTGGCTACACAGAAATTTTTTACTGGAAGTTTGCCGGATGCGGACTGGCCAGTAATGCCCGGCGTCTCGATACAAATA
GGGCGACTAATCAGGCAGTAATTAAAAAGCTTTATTCACATTAGGTGATACAAATTCAACAATTCTGCGAGATGCTTTTAGAATAGCGTAGATATTGGAA
ATACCGGACTTTTTAGTAGCACACCGTAGTTCGAGGGTTAATTCATTACTGGCAACACAGATCATTGTGGCGGAGAGTATCACGCGACCCAAGATCATCA
AATGTGTGGGCACTAGGGCTTGCAGCAGAACCTGGAGAAGATGAGGGGACCGTTACAGATAGTTCTTTAAACAGACTGAGCTTCAGCACAGTAATCTGTT
AGAGGGGTCCCAGCTCATCCTTTAAAACGGAAGAGAAGATAATGTACAGTCCGTGGCTGAAGCTGTTACCGGAGTTGCCGACCTAAGTTTGTATTTTTGT
GGCAGATTGTGACGGCCCTTGTGGTGCTGAGTCAGGATCCGTCCGCGGTCTTAGCGTCGGCACATGCGACAGGTAGAATAGTTGATTTCAGCATCTTGGC
ACAGGGTTGTAGTGATACAAGAAGTGGATTTTATTGGCACAGAATATGATGCTACAGACAGGGCAGGGCTAGATGAGTAGGTGAAGTGAAGTTGTCGATA
TAACAAATTAAGGTGGGTTTGACCTTCGACATTTTTGTTGACGTGTAGGTGATGTTATGTGTAGACTGGTGAGCCATCGTGCTCCTGTTGAGAAGGCTCT
ATCAGGGGCTCGCGTTTGGTGTTCCGAGCCAATCGAGAAAGTTTATATGCAGCGGCGAGGATACAGACTTAAAACGAATACTTTTCATGGACACGACAGT
GTAGTTGCCTCGTCTAAGAAGCAGTCTTTCGCGTAGTTCACCTCTTTTGCTCGACTTCTTTCGTCTTTTTTTTTAATATCGCAGCACGAAAGTTAGTGGT
GCTCCTCTCATTCATGGGCCTGATACAAAATGCCTTTGCTCGATAAAAACTGTTTATAAAAACTGGATTAGATAACTGTATTTTGAATTCATTCAGTTTA
TTAAACCAGGTTTGTCTGGACCGTACCCAACGAAAATTTGCACCGT