Description :
From Genome Similarity Track
Location :
contig_37:10741- 17667
Transcript NameFunction/comments
g9301.t1POM79026.1 Reverse transcriptase [Phytophthora palmivora var. palmivora
g9302.t1hypothetical protein

Sequence
6926 bases(100 bases per row)
CCGCTCTAACTGTGAACGAGGCCGAGTACCGCGGGCTGTTGTTATGCTTCTGTTGGAAGGCTTGGAGTCGATTTGCAGAGGATTGTAGACGTAGACGCAG
AAGCGAAGGTTAGTGGCGAGTGAAGTGAAGTGATTGAGCACTAGAATGAAAATTGGAAAGTGATTGAATGTGAGAGGTGGGAAAAATCAAACACACTGAC
TGCTGCTGCTTTTCCTATGCTACTGCTGTCCTACATGCACACCACGGCGCCCTTGTGTGTGCTCTTGGTTCCTTCTCATCTTGCTCAATGATGGCTCGAT
GTACAGATGGCGCGATGCCTGACTTCAGCTTGCAACGCCGCGCCGCTGACACTCCGATGACTGACCCTGATGTACCACCACGATGCTTGACAACATTCTT
TGCCTTAGTCGCCGTGAGCATTTAACACTAGATTCGTCGTCAGCATTTAACAGCTTCGATCTGCTGTCCACTATGGACAGGGGGCGAATCGTGATCTGCG
GCGATTCCAATCTGATAATCCGCCAGATGCGTGGCGAGATCGCGTGCAAGGCTTCTGGCCTGTTGTTGCTGGTCAAAAGGTGATGGATCAACTTAGATCG
TGGTCAAAACACGAGTTCCTACAGATGAAACGAGACCGGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGCTCTCCAAGGGGGCAAAGGGATCGTAATCA
CCTCAGACAAAGATCATCAAGACTTGATCACGCTCAACCGCTTGGACGATCTCCTCAAGGCGAGGGACGACGATACCATCGTCCGTGACCAGATCAACGC
GACGCAGACGACTGACGCTGAAGTCCTGCAGGAAGCGATTGTACAGCGCATACGCGGTGAACGAATCATCCAAGCGCAGAACGAAGAGAAGTGGATCATC
GATCTGAAAGCGTACCTGAAAGGGAACGTCGGGGTTCTAACCGCGGCCGAAGCTAAATCGTGCGCCAAGGTCGCGAACGACTATGAGCTGGACGAAAACG
ATCTGCTGTTCAATTGCCCGTCAGCCATGAGGCAGGACGAGGATCGAGACGAGATCGCGAAGCTGGTGGTGCCTGAAACCCTGCAGCAAGATCTCCTTCA
CGATTACCACGCAGGGGGGCATCAAGGGATCGGAAGAACGTACCGACGAATCCAATCACACTTCCACTGGAGGGGCTTGTACCGAAGTGTCCAGCGCTAT
GTGGGAGAATGTACAGATTGAGAGACAGGGAAAGGTCGACCCTTCGTGAGAGGAGAATCCCCTGGGAACGTGCAAGCGACGTACCCGTTTCAGATCATCG
TTATGGATCACATTCCGTCGTTGCCCAAGTCCTTCAAAGGCAATACGGAGCTGTTGATCTGGGTAGACCTGTTCTCGGGTTATGTGATTGCTAAAGCGAG
CGCGTCAAGAACAGCTCAGATGATTGCGGAGAACTACGAGGAATGCGTCTTCCGACGTTTTAGAGCCAGTGAGGCTACAGGGAACCCGGGTTTATGTCTG
ATTTTTTTCGTGCTTTTAGCAGGATAGTGAGACAGAAACAGTGGGCCATTATGACTTACCGACCACAGGTCAATGGGACGACAGAACGGATGGTACAAAC
ATTGACACGCGCGCTGAAGATTCATGTCGCAGACGTCAACCAGCAGGATGAGTACGCGGAGCGATTAACGTTTGCGCTCAACACGTCACAGAATCGGGTT
CGAGGAGATACGCCGTTCTACTTGACACGGATGGGACCTGCGATCTGCGTTAGAGACGTCGCTACCTCTCGGAAGTACGCGCCGACGTGATCGTGACCCG
CGTCGGTGGTGATATCATATACAGAGCCAGTATTGTCAAGCCAGAGAGTAGGTTAACGAGTCCCTGAGGGAAGCCATCCAAGGGCGAGAAGATGAGCATA
ACGATCAGGTCCGACCTCCTGGTATCGAGGCCAATATGCAAGTGTGGCTGTACCTAGATCGCGTGAAGAAGGGCTATGCACACAAATTTGCCCACATGTG
GCACGGACCGGTCAGGGTGATCGAGATGCTGGACAATCATGCAGCAAGATTGGAAATCGCTGGCACCAAATACCGGCTATTCCCGATCGTGCACGTGTCA
AAACGCAAGCCTATACGATCGTTCCCAGATCGTCCCACGCTGACGCTGGTGGTGGACGAAGGAGATCGTTTCGGCTTTGATGAGGCACTTTTGCCCGAAG
ACAGCTGAGAAGGCGGTCTCGATGAGGACGAGTTCGGAGTGGAGAAGATCGTGGATATGTGATCAGGTCGATGTACGCGGTATGGTCGCGTCCATCGAGA
ATTTCAGGTACGCTGGAAGGTTACGATCAGCTTTCGTGGGTTGATGTAGCCGATCTGAATTGCGGAGCTTTGTTGCGCGAATACGAGCGAGGAGTCACCA
ACCAAAATAGCTTCGCTACGATGCAGTCGCACGAGGAGGAGGAGGAAAGCTCGTAGCAGGTTGGCTGTTGCGGGCGGAGGAGTGGTGTGAACAGTGTGCG
AGGTGGCCGTGGAAGTGTTTTATGTGATATTGTTGTGTAAATCGAGGACGACTGTTCTCGATCGGAGCGGGATGCTCGATAAGCAAGAAAATGATGAAGA
ACAACAACAAAAGGAGAAGCCGATGGATCATATTGAGAAGACATACGATCCACTAACTACCTCATCTTAGTCGGCAAAAGGAGAGAACTTGCCGGTGAGG
TGGGACAGTTGGGAGCCCGGATGATCTTGAAGGTGACCGCGATACTGATTGCGCCACGGGTCAACCAGATCGACGGCACGTAGGGTGTCCACCAGGTTGG
AAGGCGGAGAGCTACAACCAAGTCCAGGGTACCAAACCCGTTGTTCGTCCGCCCGGGGATAATGCAGAAAGAAAGGGTCCAACAGGATATCCAAGTCGCA
GTGCCCAGCAATCATCCCTTGCAAGATCAACTTGAGGAAGCGTTTCTAGACGGCACCGAAATGGGATCGCCTCTGCTTGCGATCTTCCCAAAGCCGTGCC
AGATAAGCGTTCGATTTGCGAAGCGCGGAGCTGATCATGAACGCGTGAGTAGCCTCCCATAGAGCCTGCCGCTGATCATCTTCGATCTCCAAATACTTCC
GAGACATCGCCTCGAACCAACCAGTCACGTCAAAAGATAAGGGTTGGCACCAAGACGTTAAGAGAATTCCACAGCGTCGTCGCGTAAAGTACCGCAATAG
TGTCCTCGGTGATCAGACCGGGTGACCAAGCGCCGCGACAAGGCAATCGACTCTGCGGCGGAAAAAGCCTCGCTTCGCTAGGTGATGGAAGAGCAATTCG
ATATCCATCTCCAAGACACTGACCCGGCTCATTGTGCTCACCGACCACGGACGAACGTCAGCTGCCGCCCTACGAACACGATCGCGATATCCAGGGATCC
CGCTAGCACGGGGAACGGTGAGACCATCAAGCTGATCCAGAGCAACTTGCGCGGTTCATCAGCTACGCTTCTGTCACTGTCATCGTCATGCCCGTCGCCA
CGATCGGAATCACGTCGCGCAGTCGAATGGCTGTCCCCGCCATCATCACTCTCATCACCGGAAGAGGCACTACCAGGGTCATCTTCCAACTCTTCGAGTT
AATCGGGATCCTGGTTCGAAGCCTCCGAAGTACTTGATGACTCGATGTCGATGGGGCAGCAGGGTGACCTACCGCTAAGGCTACCGGTAGAAGACGAACG
GCGACGACCGGACGATCGCGAACTTGCAAGAGCTGCCAGTAGAGAGTCGTTGTCACTACTGGGTGGAGAGGCACGAGCAGACAATGACTGCTGGAACTGA
GAGCGGTTGTCACCAGAGAGCCTGCCGGATTTAGGAGTTGACGGTCCCGAAGAAAAAAGAGATCGCGAAGCAGATCCACCGTGAGAAGGCGGAACAGTAC
TTGATTCCGACACTGGTTTAGGGGGTCGCTGTCACGGACGACTACGGGGCGGACTTGACCTGTCATACCACGCGGTCGCTTGATCGCCTTCTTGGATGCG
GCAGGCGTTGACTTAGAAGAGGAAGAAAGTGGTGCTGCGTCTTGCTCTGGTTGGATGAACGAGATCAACCCCGCCACCCTATTGCGGAGCTGATCGCGGT
CTTGTATCGCACGGTCATGGTATCTTTTGAGTGCAGAAGATGCCGGCTGTGCGTTAGCTAAGTCAGCAAGGAGCAACTCGTTCTCGTGATTGAGCGTCTT
GATGCGACTATGATCTGCCTGCGACATTTTCAGACCACGCTCCAATCGAGCGATTGACGCCCGCGCGTTATCAACTTGGATCATCGATACCAAACATAGA
AGAATAATGTTAGCGCCACGCGCGAAAGACTCATCGGACGTACGAGGCGGACTTACGAAGTGATCGGCGGTCAGCTAACGCCCGATGGCGATCAGTCATG
ATCTGTTGCCGGTTGCTGGAAGTGGTCCGAAGCGTGGCCTCAACAGCCTCTGCACGAGAACGAAACTGTTCTCTCTCTGCGTCGATGCGATCGAAGTCCC
GCTTGGCTCGAGCTGTCTGTTGGGCCAGCTGTGCTTGAAGATTAGACACGCGCTGCTCGAGACGTTCGTTCTGACCGCGTAGTCGAGACGTCGCGTCCTC
TAATGCGCGCTGCGACGACTCAAGTGCGCCGAGTATCTTGTTGGCTTCGGCCAAATCCAAAGCGGCGCGGTCGCGATCTGCGATCGCCTGGTCCAACCCT
TCCTGTAACGTGGCGATACGACGTTCTGACCCCGGCGGCTGCTGTTTAGCCGCCGGAGACTCTACATTAGCCAGAGGACGAGTTAGCTCGCCGATCTCCG
CTTGTAATCGTGCTGTTTCCTCCGCGAGGACCTTCTCAGCGACGCGCAGACGATCCGGGACGGCCGCGATCTCGTGCAAATTGTCGAGACGCTCGCGCAC
CGCCTCTTTGAAGTCAGCCGCCACCTGCTGGGTTTCTTGATAGCGCCGAACAGGAGATCTTATTGGTGCTGACAATGTAGCACATACGGCTGCGTATGCA
GAGTTCAGGTCAGCCTCCAATTGGTCAGCACGTGCCAGTTGGTCGCGATATGCACCGCGTGATCGTCGTCGAGATCAGATTGGGCCTCAATACGTTCCAT
CACGGACAAAAATATTGCGAGAGAGTTTCGGGCGGCGCCGAAGTCAACGCTAGGAAGCGCAACGCGAGCAGTGGAGACGACCGGAGCCTCAGAGATACGG
CCAGCGGATGTACCAGATGCAACAGCGGGAGGGTCTTCGGACGGCGCGTCAGTTGCTCCAGTCATGACTGTATCTAGCACGGAGGCTGGTGGTGGTTCAG
AGAAGGAAGCAGAATTGTTATGGAATGCGCTGAGACCAACCACCGTACGGTTGGTCGTAGAGCAGGGGGCGATTGAGGTGAAGTGACGTGGGTCAAACTG
CCGATGATGGGAAGAGATCGCGTCTGGACTGATTGAACCAGAAGGGTTTGGGTTGGTGTCGGATATTTTCGGATGACCCCAGTACCTGACTTGGTACCAC
AACGAGGCTACAGGTAATTATTTTTCCTGGTACCACCTTTTCGGTACAGTCGATCATCTTAACACCTGCGATCATCTGGACACCCGCGATCATCCGAACT
CACCTGATCAGATCGACATGGTACCACCCCGGTGGTACAGTTGAATTGGATTGACACTGGTTATGATGGTACTGGTTGCGAAAGAAGTATACTCCACGTG
AGAGTGGAGGGGAATATCGGAATGTTAACGGTAAACGTAAGCAGGCGCTCGGAGCTGTTTATCTTTCTTTTGTTCTTCCCCACTTTTCGAACAAGCGATG
TTGTTCTCAGGAATTCATGGTGATAGACTAGATGGTTCGTCCACTTATTCTGGGGACAGATTTCCTACAACAACAAGAGATTGTGATTGATTATCGGAAG
GAAGTTATTCCATGGGACGGAATGGAGCTAGTCATGGAAACTAAATCGAGGCCAGAAAAACGGGTAGCATTTGCATTATCAAGCAAAGAGGACCGCACTT
TACGCATCCTGGATGTGACGGACAAAGAATTCGATCTAAATGCGTTAGTGCTGAAAGAACATTTGAAACCTGAACAAAAAACAACGTCTCCTGGCACTAC
TTGAAACATTTAGGATGGTGTTTCTGTGGGAAATCGGCAAAATGAAGTTGCCGCAGTATAAACTGCCAATTAGACCGGGTAGTCAATCAAGCGCACAGAA
GTCATATTCCATTCTATTGATTTACAAGGATGGTACTTTACGCGAAGTAGAGAGATTGGTGAAGCTTGGAGTATTGGAAATAGACAAAGATTCACCATGG
GCTGCACCAGCATTTATTATTCCCAAGAAAGATGGCATCATACGATTTTTATCGGACTTTCGACGTCTTATTCTTTGCATGGAGCGACGATATTATCCGC
TGCCTCGGATTCAAGATGTGATCCGGGAACTACCAAACCAGCGTTTGTGACAGCGCTAGATTTGGTAATGGGCTACTACAGTCGCGAATTATCTGAAGAA
AGCCGGTCATGTACTCCCCTGGGGGAAGTATCGATATTGCCGGTTGCCGATGAGAATTAGTACCGCGCCTGACGAATTCCATGCTGTAATGCAACAGTTA
TTAGGAGATTTGGTATCTGTGAGAGTGTACTTTGATGATGTTCTAGTGTTTTCAAACACTTTTGATGAACATTTGCAGCATTTGCAAGTGGTACTTCAGC
GACTCAAAGAGATGTGGGAGTAGTGGTTCACTCGACAAAGAGCAAATTCTGCATGAAAAAGGTTGAATATATTGGGTTCCAAATTAGCACAGGAGGAAAA
CAACCGATGAAAAGAAAGGTCGAAGCTATTGCGCGTCTTTTGCGGCCATGCACTATCCGTGATCTCCGACGGTTCCTCGGGATGATTAATTATTGGAAGT
ATATGTGGCGTGAACGGTCAGAAGTT