Description :
From Genome Similarity Track
Location :
Scaffold_5:10740- 11938
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_5-snap-gene-0.33Myosin

Sequence
1198 bases(100 bases per row)
TGAGGTCCAAGGACGTGAAGCGAGACCAAACGATCCTTGTCAGTGGCGAGAGTGGCGCTGGAAAAACTGAGACGACCAAGTTTGTCATGAATTATTTAGC
AGAATGCAGCGGCAGCGGAGAAGTGACCGAGAGACCCGATGAACGTTCACACAAAGAAGAAGGCATGAGCGGAAGTCAATTGATGAGCGCAAACCCGATC
CTCGAGTCTTTTGGAAATGCGCGGACACTGCGGAATGACAACAGTAGTCGCTTTGGCAAGTTCGTGCGGATGTACTTTGATTCGGTGAACCAGGACACCG
ATGACGATGCGTTGGTGATGGTCGGGACGTCTGTGGAAACGTATTTGCTCGAAAAAGTGCGCGTGATTCACCAGACCCAGGGAGAGCGAAATTATCACAT
TTTCTACGAACTGTTGGCAGGCGCCGACGACAAGCTCAAAGCTAAGCTGCACCTGACAGGATTCAAGGCAAAAGATTTCCAGTACGTGAAAGGAGGCAAT
TGCTTTCAGAGAAACGATGGCGTTCAAGATGGGAAGCAGTTTCAGCGTGTGCTGGAGTCAATGGACATTCTCGGGTTTACTCATGCAGAACAAGACAGCC
TTTGGAAAACGTTGAGCGCACTGTTGCATCTCGGAAACATTGCCTTTCTCCCATCGACAGACGAGGATGATGAAGCCAATTCCAGTTCACCAGCGCCATG
CCGAATCTCTCCGAAGTCTCCGTCTTCATTGCCAGCAGAGAAGCATTTAGAGATCGTCGCAGACTTGCTCGGTGTTGAGCACGATCAATTTCGGTCGGCG
CTGACAACAAGGAAAATCAACATTAGCGGTGAATGCTTCCATGTGAATCTAAGTCAAGCGCAGTGTGGTGATGCAAGAGATGCGATGGCGCGCTCATTGT
ACGGCTTCCTGTTCCAGTTCTTAGTGAACAAAATCAATGTGCATTCGCCTCAGCAGCAGAAGTCTCCGTTCCAGTCGACAGGCTTCTCTGATGATGATGA
TGCGAGTTCCCTATTGTGCATCGCTGTGCTTGATATTTTCGGATTCGAAGAGTTTGAAGTGAACTTGTTTGAGCAGTTCTGTATCAATTATGCGAACGAG
AAGCTCCAGTACCAGTTTATTCAAGACATTCTGCTCACGGAACAACAAGCACATATCCAGGAAGGGATCAAGTGGAACGCTGTGGACTATCAAGACAA