Description :
From Genome Similarity Track
Location :
Scaffold_70:1074- 6091
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.3Replication factor C subunit 4
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.8WD domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_70-snap-gene-0.24Ras-like GTP-binding protein YPT1

Sequence
5017 bases(100 bases per row)
AAGTCCGAGGCCCCGCCGGCGTCGCTGCCCTGGGTGGAGAAATAGTACGTTGTCATATATGTGTATACGCTCTGTTGTGGTGTGGTGCTGGTTGGCTCAC
GCATGCCTCTCTCTCTGAATACGCAGCCGCCCGAAGAACGTGGACGAGATCTCGCACCAGGAGCACGTGGTCGCGACGCTCAAGACGTCGATCGCGAGCG
GCCAGCTGCCGCACCTGCTCTTCTATGGGCCGCCGGGCACGGGCAAGACGTCGACGATCGTCGCGGTCGCGCGGCAGCTCTTTGGACCGGACTTCCGCAA
GAACGGGCGCTTCCTGGAGCTCAATGCGTCCGACGACCGCGGCATCAGCGTCGTGCGCGAGAAGGTCAAGGGCTTCGCGCAGGGCGCGATCAGCGGCTCG
AGCTCCATGCCGCCCTTCAAGATCATCGTGCTCGACGAGGCCGACTCGATGACGAACGACGCGCAGTCCGCGCTGCGCCGCATGATGGAGAACTACTCCA
AGGTCACGCGCTTCTGCCTCATCTGCAACTACGTGAGTCGCATCATCGAGCCCGTGGCCTCGCGGTGCGCCAAGTTCCGCTTCGCACCGCTTGAGAAGAT
CTCGATGGCCACGCGCATCCGGTACATCTGCGCGGAGGAGCGCATCGCGACGAGCGACGAGGTCATCGACTCGCTGCTCGACTGCTCGAACGGCGACCTG
CGCAAGGCAATCAACTTTTTGCAGAGCGCCAAGCAGCTCTGCGGCGACGAAGAGCTCTCCAAGGACGACGTGATCGCAGTCGCTGGCGTACGTATATCTT
GGTTGTTGTATCGGATCTTTGTTTTATATGTTGTGTGGCTCAACGTATATGATATGTTATGTAACACATGTATTATAGCTGGCCCCGCCGGAGCTGCTGG
AGCTCTTCTGGGAGTCGGTTAAGAGCAACAGCTTTGACAAGATGAAAGTCGAGATCGAGAACATCCTCATGTCCGGTTATCCGGTGCTCACGATCCTCAA
GCAGCTCAGCGACGACGTGCTGAATAATGCGAAGCTGAGTGACTTGCAGAAGGCGAAGCTCTGTCTGCGGATCGCCGAGGCCGATAAGAAACTGGTCGAC
GGCGCCAGCGAACACTTCCAGCTGCTGGACGTGGCCTCGTACATCATGCGCGTCTACTACTCTGCATAAAAGGCTCGTCGTCGTGGTAGCCAATAAAGAG
GAGATGTCTCGGAAATGAGCATAGTAAAAGCAAGATGAAAATCCAATTTGATCGTTTATTGCTCGTAAAAAGGTTGATTGATCCCTTAAGTGACCGATAC
GGTACTTCAGCTGGGTACAGACTCAGCTCAGCTCAGGAGCTCAGGACCTGGGCGCCGTGCTCGTTCACGGACGAAAGCTGCACCCACTCGCTCTCGCTCA
GCTGCTTCCAGAAAGTGACCTCGTCGTCGCCCACCGCCACGCTCAGCACGGTCCCCGTGAGCGACCAGCTTATCCGATACACAGGCGAGCGGAATGTGTG
GACCACGTGCATCTTCCAGTCGCCCGCGGCTTCGTCCTGGCTCCAGACGCGCACCGTGTGGTCGTCCGACCCGGACGCGATGATGTTGGCCGGGATGCCG
ACGTTGGGCGCCCAGGCCACGTCGCGGACCCAGTCCTCGTGGCCCACGAGGGGTGCGTCGTCCGCCAGCGTCCACTGGTTCTCCTGGGCCGCAAACTGCC
AGATTTGCACCAAGCTGTTGACCGAGCCCGTGACCACGCGCTGGACGGGACCCTGCGGGCCCTGCGAGCCCAGCGAGTTGTACGGCGCCCAGCTCACGGA
GCTAGCGGCCACACCGTCCTGGGAGTTGATGAAGGACGACGACGTGACCCAGCCCTCGCGCATCCTCGACAGGAACGACACTTGGCCGTCCGCCGAGGCG
CTCGCGAGGCACAGGCCGTACTCGTAGGGCGCCCACTCGATACTGAGCACCGCGAGCGAGTGGAACGCGTGCACGTACTTGAGCACCCACTCGGTCGCGC
TGCTGCCGTTCGGGTGGAGCTCCTCGCGGTACACATACACCCGGCCGTCCTGACAGGCCATCGCGAGCAGACTGCCAAACTTGGGGTGCGCCCAGGCGAT
GCGGTGCATGGACGCGTTCGAGTCGTCGGGCAACTGCACGATGTGCTGCAACACATGGCCAACGGGTGCCGCTGCATTCGGGTCCGCAGTCGCTGCGGCC
TTGGTCTTCTTGGGGTCCTGCTGCGAGGACGGGACCGTGGCCTCCGACACGTCGTAGACGCGGAACGTGCGGTCGCCCGAGCACGTCACGAGGCGCTTGC
CATAGTAGTCCAGCTGGATGTCGTTGATCATGTCGTTGTGCTCCGTGTCGATGCTCGTGAGCGGCGCCGTGCGCTGCTGCTGCTGCTGGCCGACGTACTC
CATGGCGGCTTCCCTCTTGTTGCCCGTGTTGGATATCGAGCACGTGTTGCGATTGTGTCATCACATAGAGGTGGGTGCGCAGAAGTACAGTATCAAATCT
CTACAAGAGACTCCTCATGAATAGAGGTGACCTAAATCGGCGTTGCACTTTTTTGCCATTTTGAATTTTGTCATCGTGAAAAGCTGCACAAAGGTGATCG
ACGGGAGCAATGTTCGCGATCAATGGACCGAGCGGACCGACGAGCCGCAACGAGCGCCGTGTGGTGACAGAGGCAGAGCACAAGCAGCGCGACGCGGCGC
TGAAGCAGCAGGTGAAGCAGAAGGGCGAGAGCTTCTTCAATGTGCGCAAGACCAGCAGTGTAGCTCCGACAAAAGCTGCAGCAGGCAGCGCTTCCGCGTC
CATCAAGCGTGCGTTGGCAGGTGCTGCTGCTACCACAGGCCCCGATGAAGTTACTTGTGGTGGGCGCGTGTCGTGATGTCGTATGTTGTAATGTGTGCTG
TGTGTGTGTCCGGTTGGTGACTGAAATTTGGCTGTGTTCAATGTATGGACAGCAGAGCAGGCGACAGCTCCCAAGAAGCAAGTGAAGCGTGACAACATCG
CCACAGAGACCCAGATCTTCAAGGTGAGCACAGAGTTAAAAGCTGAGCATGGCGTGTTGGCTGTGAAGCTAATACGTAGTGATGCTGTTATATGCAAAAC
AGGGCTGTCGGATAATTTTCAACGGACGCACTGGCAACATCTCCTCGTATGTCCATGGGCTTGCGCTCCCTATGTGCAACAGTGCCTTCACTAATCTGTC
GATACTATTGTTGCTATCTTTGTGCAGCTGCTACTTGGCCAAGCTCGTACAGGACTACGGCGGCAACGTTTGGTGAGGGCGAACGCCGTTTGACGACCTT
CCCTTCGTGTGGAAATGGGTGAAAATCGATGCTCATCGTGAAATTGCTTCGTTGTTCAAACAGCTCTGCGTTTGCTGCGACGCGCGTGACGCACATGGTC
AGCGCGAACCTCAGCGGCTCCAAGGCAGAAAAAGTGCTCAAGGTACTGCCATTCAGTCAGCAGCGCCCATTCCCATTCTTCGTGGTGATACAACCTGCAT
TTGGCTCACAACTCTTGTTGAAAATTCAGACGGCAGGAAAGATCAAGGTTGTCAGTCCAGGTCCGTGCTACTCGTCTCAGTGCGTCAGCCAGTCGCTCAC
ACCCATACTCACAACAATTGTTGATATACATGGCTACAGACTGGATCCTGCAGTCCGTGAAGCTCAAGAAGCGGCAGTCCGAGTTCGAGTTCCTGCTCTA
CAAGGACGCACAGCAGCTTCGCATGCGCTGACTCAAGTTCGCATTCGCTTCTCTTCTCATCACACAGTCGAGAGCGGCATCACACTGTAGAATAAAACAA
GCAAAACATGCAGGCAAGTATAGAGAAGAAAATTGATTTTTGTTGATTAGAACACTACCAACTCAGTCATACCTGTTAAGCTGGCGGCGTCCCTACCTTG
ATCAGCCAAAAGAGAGAATGCAGAGAGGAAATAGAGCGTGGGTGGGGGAGTTTTCTGTGTCTTGCTTGAATGCTGCGATCGGTCTTATCCGATTTCCTCC
TCTCCGTCGCACCAGCTTCGCCCTCGACCTGCTCTCTCGCGACTGAACAGGGACAGAGAACTGATTTTCCTTTCGTCCAAGTGCGACCATCTACCGGCTT
GAACGCGAAGAAGAACAGAAGATGCAGGGGCGACGGGGGAGCGACGGATCGTTCGGGAAATGCGGAGGAAACGACGCAGCGATAAATCATCCAACCGCTT
AGCAGCACTTTCCGCCCGAGTTGGACTGCACGTTGGTGCCCGGGGTGATTCGCACACCAGCCTTCGGGGCAACTGGAGCATTCGCCATTCTCTTCTTGAT
CTGGGCAGCCATCATCATGAAGGCCTTCTCGACGTTCGCCGCGTTCTTGGCACTGGTTTCCAAGAACTCAATGCCCAGGCTCTCGGCAAACTCCTTGGCC
GCCTCCGTGCTCACCACACGCTTGGCCGTCAAATCGCTCTTGTTACCGACAAGGAGCTTGTTCACGTTCTCACAGGCGTATCTGAAAGAGAGCAGTAGCA
ATAGAAATAAGTCAGTAAATTTGTCCAGACTCAAACAACACAAATCTCATCTCAGCAACAAAGCAAACACATACCGGTCAATCTCGTGCAGCCACTGCTT
GACGTTGTTGAAGGACTCCTGGTCGGTCACATCGTACACGACGATGATACCGTGCGCGCCACGGTAGTAACTGCTGGTGATCGTGCGGAAACGCTCCTGG
CCGGCGGTATCCCAGATCTGGAGCTTGATGGTCTTGCCGTCGAGCTCGATGGTGCGAATCTTGAAGTCGACGCCGATGGTCGAGATGTAGCTCTCCGTGT
ACGTGTCGTCAGCGAAACGGAGCAGCAGACACGACTTGCCGACACCGGAGTCACCGATGAGCAAGAGCTTGAAGAGGTAGTCGCTGTACAGATGCAACAA
TACAAACGCGTTCGTTAGAACTTCTCATTCCTCAGCCAGCGCCAAACATGAATCAGGTCCATTTGCTGTTATCATCACTTACTATTCTGGGTTCATGGTT
GCTGAAGAGAGAGACAA