Description :
From Genome Similarity Track
Location :
Scaffold_771:1074- 2721
Transcript NameFunction/comments
Phyke_g10989Neprilysin CD10, peptidase

Sequence
1647 bases(100 bases per row)
TTGTGTCGGTGTCCCTCtccgtcactgtcgtcgtggtgatgatgttcttcttctgccttATCCGATTCGCTGTCCTTGCCGTGCCTCTTGTCGTGcttgt
tgtcttcatcttcgttaTGTCGGTGCTTGTGGCGGCCGTTTTCTCCGACGCTGTCTTCGTGATGATGGTGTTCTTCTGTCTGATCCCACTTGTCGTCCTT
GCCGTGATTCTTTCCATGCCTTGCACCCTCGCCTTCATCTTTAGTCGCCGAGCCATTTTTGTGTCCATGGTGCTTCCTGtgctcatcatcttcgtcattc
TTCCCATGCTTTTCGGTGTGTTTGCCTTTCGATGGATTTTGgtcgtcttcttccttggTATGGTTGACATCACCATGTTTGCTGCCATGTGATTTCTTTG
ACGGATGCTCttgctcctcgtccttcttctcgtgcttTTTGGGAGAGTGTTTGTGACCTTCGCTACTTTTTTCGCCATCTTTACCATGCCCCAATTTGTC
AGATTTCTTGTGCTTCTCTGAGTCGCTTGCTTTCTTGTGATCATGCTCCTCCGCAGGTGCACGATCGGGCGTCTCGTCACTTGGCTTCGTCTCTGGCGGT
GGGTTGCTTGTATCGGTAGGAGACCCAGGTGACGGGGACGACGTAGTTGGTTCTTCTGGAAATGGTAGCGATGGAACGGGTGCCGGAACCTCTGCAGGGG
GCTCCGTTTCCGATGGTGGTGTTACGACTGGGATATCCGTAGCGGGTTCTGGCTGAGgggtttcttcttctggcacCGGAAAAACAGGAGCAGGTGACGT
AACCTCGGGAATCACTTCTCCTGGTCCTACATCCGCAGGCTGGGGCTCAGGGATGACTGGTGGCCGAGACGGCGTTACAACCGGGATTTCTCCATTAGGC
GCTGGTTCAGGTGTCAGTGCGTCAGGATCAGGAACCGTCACCTCAGGAATCTCTCCACCAGGACCAGTTTCAGAAGGCTCTGGGACTGGTTGATCTGGAA
TCGGGATGACTGGTGGTGTCTCCACCGGGCCCACTGGTGTTGATGGCTCCGGTTGCGGCGGTACCTCTTCAGTGCCAGGCGTCATCGCAGAAGGGGAAAA
CGTACTCTTCCAAAGGTGATACGCCTCATATGCAAGGTGGATACCACCGTTGTCAGCAATGTTTTCACCCAGCGTCAAATTGCCATTTATTGTGCCCAGA
ACATGCCCATCTTCCACGGAGACTACCGGGAATGTCGAGTATTGGGCTGACAAACACTGGGCCTTCTCCGCGAATTCATCGGACACCGACGGTGTCCACC
AAGAGCGTAGCGCACCAGTGCCATCGTAATTGCGCCCTTGATCGTCAAATCCGTGCGAGAGTTCGTGCCCCATCACCATACCGATACGAGCAAAGTTTGC
AGCCGCCGGGAAATGGTCAGGACTGTAGAACGGTGGCTGCAAAATAGCAGCAGGGAACACCATCTTGTTTGCACTCGGATCATAGTAGGCGTTAACCGTT
GAGGGGAACATATCCCAGGCTTGAGGGTCTACTGGCATGTTGATAGATTGAATGGCTTCCGTTGCGCTCAGCTCCATCAAGCTTCGCACATTGTTGAAGA
ATGCATCGCCTTGGAGTGTAAATGGTAGCGGTGGCACGACATCAGGA