Description :
From Genome Similarity Track
Location :
Scaffold_1643:1074- 2696
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1643-snap-gene-0.1Folate-Biopterin Transporter (FBT) family

Sequence
1622 bases(100 bases per row)
CGATCCGACCGCGATGGCGCGCCTGTCGTACCTGAGCGGTGCGTCGCAGGCCAAGGACGTCGAAGAGGGAGGGTACACGAGTGCCAAGACCCCCGAGCCG
CTCGAGGACGGTGCGCTTCGCGTCGGTGGTCGCCCGATCCTCACCAGCCGCGAGAACATCGGACTGCTCGTGCAGTACGCCGTCGTCGGTCTGGTTTACG
GCTCGTTGCCCGAGACCATCTACCCGTTCATGCAGCAGTACCTGAACTGTACTGGTTCGCAAGTGACGACAGCCCAGACCCTCGTGGTGCTTCCGTGGAG
TTTCAAGGTCNNNNNNNNNNTATTCTGTCCGATTGTTTCCCCATCCGCGGCTACCGGCGTCGTCCGTACATGCTCCTCGGCTGGAGCATCTGTTTCATCA
TGCTTCTCGTGATGGCCGTCATGCCGATCGGCAAGCCGTACTTCACTCACTCGGCTGATCGCGATGTCGACCCGTCCGACTACACGGACGAGATCCGTGC
GCGCATCAACTACGACGCTCCATCGGAAGGTGCCAAATACGTCATGCTCATGTTCTTCGCGGCTTTCGGATACGTCATGTCGGACGTGTGCGCCGACAGT
ATCACGGTCGAGCTCGCCCAGCGCGAGCCGGAGGAGTTCCGCGGCAAGACGCAGTCGATGATCTACATTGTGCGTACGAGTGTCGTCATCGTTGGCCAGA
TTATTGTCGGCTTCTGCTTCAACGGCGAGGAGTACGGCGGCGACTTTGACTTCTCGCTGAGCTTCCCGCAGCTCATGATCATCTTCACTGTGTGCACCAT
TCCGGTGTTCCCCGCGACGTGGTTCTTCATCAAGGAAGAGAAGCACGAGAAGCCCAACTTCAAGCAGTACATGACCGGACTCTTCGATCTCATCTCGAAG
CGCGCCGTCTTCCAGGTCGTCTGGTACATCTTCCTCGCCAACATCTTTGCCGACATTTCGTACACGGCGAGCTCCCCCGTGCAGTCGTACATGGTCGGCG
TCACGCCCATCAACAGCACGCTGAGCGACATTCTGAGCAACCTGCTCTTCATGTTCGGCCTCATGATCACGTCCAAGTGGGGACTTCGCTGGAACTGGCG
GCTCATGATCGTCGCCACGGGACTCTTCGTCATCGCGATCGACCTCGCGACGACCATGATCACGGTCTGGGACGTGTTCCGATCGCAGTGGTTCTGGCTC
GGTCCGCCGATCGCCGTTCAGCTTCCGGCCGGTGTCGGCTGGATGATCGGCAACTTCGTCATTGTCGAACTCGCCGGCGAAGGCAACGAAGGCGCCATGT
ACGGTTTGGTCACGACGGTGTTTAACACGGCGTCGCCGTTCGCGACGACGCTGACGCTCGTGATGGACCAGCCGTTCAACCTGACGACGGAGCGCATCCA
GGAGGACGACCACTCGGTGCGCAAGGACATCACCTACGTGGTTATCATCATGTACTGCTGCACCATGTTCGCTTGGGTGTTCCTCCCCATGCTGCCGAAG
CAGAAGGAGGCGACGCAGGAACTGCTGCGCACCGGAGGCACCAACAAGGTCATCGGCGGCGTGACTATCTTCGTCATCTGCTTCGCGCTGATCTGGTCTG
TGATGACCAACATCATGGCCAT