Description :
From Genome Similarity Track
Location :
Scaffold_860:1074- 2392
Transcript NameFunction/comments
Phymu_g12190Equilibrative Nucleoside Transporter (ENT) Family

Sequence
1318 bases(100 bases per row)
GTGCAAGAAGACCCATTGGAGATCGGCCGCGATGGCATGCCGCCCGAGATCTGGGACGATATGGTCAAGCACGAGAAGTTCATCTACTTCTCGCTCATGT
TCCTCAACGGCTCCGTGCTCTGGGCCTACTACTCGTGTCTGAGCGCGCAGGACTTCTACTCGGTCGAGTTCCCGGACTCCGGCCTTGACTTCTCGTTCCT
GACTACACTGTGCACGGCCTGGCCCATGGTTCTCGGTCAGGggctgcagatgctgttCGGTCTCGACAAAAGGTTCAGTCAACGCACTCGCGTGCACGCG
GGCTACTGCATCTTCATGGTCATGGCTATCCTTATCATGGTCTTCAGTGCtatcaacttctccagccaAAAGACGGGAGCTATCCTCGTGCTCGTGTGCT
TCGGGTGCATCGGGTTCGGCAATTCGCTGTCCGAAGCCACGTACTACACGTTCGCGGCGCTGTTCCCAGTCGAGAAATTCACCAATGGCGTGCAGATCGG
CAACACGTGCGCCGGTGTCCTCAACATTACAGTTGCCACTGTGCTGCGGCTTGCGGTTGGCGGCGTGAACcagaccagcagctctacgaAGCTGAGCTTC
TACCTCTTCTTTAGTCTGTTGGTAATTGTCCTGATATGCGCCATCCTGCTGTACCGCTACTTGGTGAGTCTGCCGTCCGTCAAGTTCCTCATGGAGCGCA
ACGAGAACTCGGCTAAGGAAGAGCACCTCGCGCACCAATCGGTCGGTCGTACGTTGAAGAACCTGTGGCGTATCTTCGCCATCATCTGGATGCCAGCACT
TGCTCAGttcctcatcttcttcgtgtcgttGTCCGTCTTCCCCGGTTTCGGGTGCGCGGCGTCTCGGAACTTGTATCCGCCGTATAACGACGAAGCCCAC
GCCCTCACCGGGACATGGTACTGCTCTCCAGGCATCATCGGCAGCTACAACTACGGCGACTTCATCGGTCGTATCGTGTGTACGGCCGCAGTGTACCGCG
TGGTTACTATGGGGTGGGCGTTCGGGTTGTCGGTTCTCCGAATCGCCTTCATCCCGCTACTGCTCATGGGGGTGGCCGGCACGTCGTTCTACGCGTTCCC
GTTCGGTAGTATGGGCGCGTTGGCCTTCAACATCGTGCTGAACCTACTCATCGGCATCTCCACCGGTCTGCTTTCGACTGTCACAATGGGCGTGGCGCCT
CGAATGTTGAAACCGGAAGACCGCGAATCGGGCGGTGCTGTCatggtcttcttcctgttcctcgGTATCGCCACAGGCTCGACGTTCGGCTTCCTCGTGA
GTGACAACGGCTGGCTCG