Description :
From Genome Similarity Track
Location :
Scaffold_1087:1074- 2134
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1087-fgenesh-gene-0.1Glucan 1,3-beta-glucosidase

Sequence
1060 bases(100 bases per row)
GCCAGTCTCCAACTGGCGTTACACAGCTCAGCATCTCCTCACTGTACGCGACTAGTATGCTGAAGCGACTTGTGGCGCTTACGGTGGCGCTGGCGTTGGC
CATGAGCGACGCGCTCAACGTCAAGCTCTCGGGTGTGAACTATGACTTACGGCAAGGTCCTGACGGCTACGCATAGCGATGCAAAAGTAGTGGCAAGGTC
GCGTCGGAGATCCGGCGCCTGCAAACCATCACTAATCGCGTACGCATCTACAGTCTGACGGACTGCGATGTCACGCGCGTGCTCACGCCGGCGCGCGACT
TGAACATGACGGTGTGGCTTGGTCTGAGGGTCAGCGAGAAGCGAACAGTGTTCAGCAGTGAAGTGGCGCAACTCAAGTCGCTCATCATGAAGCAGCTCGT
CACGAGTGAGCTCATTGACGGCATCAATATCGGTAGCGAAGCGCTCTACCGTAACGAGACGACAGCTGACGACCTGGTGACCAAGATCGGCACTGTGCGA
ACGCTCCTCAAGGAGAATAACATTGACATCCCGCTATCTATCACTGACACTCTGGGTAACCTCGCAGAGAACCCAGAGATTGTGAACACTGTCGACGTCG
TTACATTCAACCAGTTTCCGTTTTGGAACAAGGTGCCTATCGAGTCAGCTGTTGCTGACATGGAAGGCTCTATCGACTCGTTCTTCAATAGCACCAAGTC
AAAACCCTTTGTCATCACCGAGACGGGGTGGGCAGCAGCAGGTGAAGACAAAATGGCGTCGAAAGCTTCACCCGAGAGCGCAGCGGTACGGACTCGTTTC
GTTTGATAAGCTATCTCTCACTTACCACTCACGCCGTTGTTTTtCTTtCAGCGATACATGAAGGAGTTATATCTCCTCACAGAGAAGCGTGGCTGGAAAT
ACTACTACTTTGCTGGCTTTGATACCCCATACCGTCAGAAAGTAGAAGGCAACGCCAACTCGGTCGAAGCGTTTGTCGGTATCTTTGATGACTCTGGACA
CATGAACAAACACTACGATGATCTCACCATACCAGCCCTGAAGATGGTTGACGGTCCCAC