Description :
From Genome Similarity Track
Location :
contig_37:10739- 17665
Transcript NameFunction/comments
g8878.t1hypothetical protein

Sequence
6926 bases(100 bases per row)
CTAACTGTGAACGAGGCCGAGTACCGCGGGCTGTTGTTATGCTTCTGTTGGAAGGCTTGGAGTCGATTTGCAGAGGATTGTAGACGTAGACGCAGAAGCG
AAGGTTAGTGGCGAGTGAAGTGAAGTGATTGAGCACTAGAATGAAAATTGGAAAGTGATTGAATGTGAGAGGTGGGAAAAATCAAACACACTGACTGCTG
CTGCTTTTCCTATGCTACTGCTGTCCTACATGCACACCACGGCGCCCTTGTGTGTGCTCTTGGTTCCTTCTCATCTTGCTCAATGATGGCTCGATGTACA
GATGGCGCGATGCCTGACTTCAGCTTGCAACGCCGCGCCGCTGACACTCCGATGACTGACCCTGATGTACCACCACGATGCTTGACAACATTCTTTGCCT
TAGTCGCCGTGAGCATTTAACACTAGATTCGTCGTCAGCATTTAACAGCTTCGATCTGCTGTCCACTATGGACAGGGGGCGAATCGTGATCTGCGGCGAT
TCCAATCTGATAATCCGCCAGATGCGTGGCGAGATCGCGTGCAAGGCTTCTGGCCTGTTGTTGCTGGTCAAAAGGTGATGGATCAACTTAGATCGTGGTC
AAAACACGAGTTCCTACAGATGAAACGAGACCGGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGCTCTCCAAGGGGGCAAAGGGATCGTAATCACCTCA
GACAAAGATCATCAAGACTTGATCACGCTCAACCGCTTGGACGATCTCCTCAAGGCGAGGGACGACGATACCATCGTCCGTGACCAGATCAACGCGACGC
AGACGACTGACGCTGAAGTCCTGCAGGAAGCGATTGTACAGCGCATACGCGGTGAACGAATCATCCAAGCGCAGAACGAAGAGAAGTGGATCATCGATCT
GAAAGCGTACCTGAAAGGGAACGTCGGGGTTCTAACCGCGGCCGAAGCTAAATCGTGCGCCAAGGTCGCGAACGACTATGAGCTGGACGAAAACGATCTG
CTGTTCAATTGCCCGTCAGCCATGAGGCAGGACGAGGATCGAGACGAGATCGCGAAGCTGGTGGTGCCTGAAACCCTGCAGCAAGATCTCCTTCACGATT
ACCACGCAGGGGGGCATCAAGGGATCGGAAGAACGTACCGACGAATCCAATCACACTTCCACTGGAGGGGCTTGTACCGAAGTGTCCAGCGCTATGTGGG
AGAATGTACAGATTGAGAGACAGGGAAAGGTCGACCCTTCGTGAGAGGAGAATCCCCTGGGAACGTGCAAGCGACGTACCCGTTTCAGATCATCGTTATG
GATCACATTCCGTCGTTGCCCAAGTCCTTCAAAGGCAATACGGAGCTGTTGATCTGGGTAGACCTGTTCTCGGGTTATGTGATTGCTAAAGCGAGCGCGT
CAAGAACAGCTCAGATGATTGCGGAGAACTACGAGGAATGCGTCTTCCGACGTTTTAGAGCCAGTGAGGCTACAGGGAACCCGGGTTTATGTCTGATTTT
TTTCGTGCTTTTAGCAGGATAGTGAGACAGAAACAGTGGGCCATTATGACTTACCGACCACAGGTCAATGGGACGACAGAACGGATGGTACAAACATTGA
CACGCGCGCTGAAGATTCATGTCGCAGACGTCAACCAGCAGGATGAGTACGCGGAGCGATTAACGTTTGCGCTCAACACGTCACAGAATCGGGTTCGAGG
AGATACGCCGTTCTACTTGACACGGATGGGACCTGCGATCTGCGTTAGAGACGTCGCTACCTCTCGGAAGTACGCGCCGACGTGATCGTGACCCGCGTCG
GTGGTGATATCATATACAGAGCCAGTATTGTCAAGCCAGAGAGTAGGTTAACGAGTCCCTGAGGGAAGCCATCCAAGGGCGAGAAGATGAGCATAACGAT
CAGGTCCGACCTCCTGGTATCGAGGCCAATATGCAAGTGTGGCTGTACCTAGATCGCGTGAAGAAGGGCTATGCACACAAATTTGCCCACATGTGGCACG
GACCGGTCAGGGTGATCGAGATGCTGGACAATCATGCAGCAAGATTGGAAATCGCTGGCACCAAATACCGGCTATTCCCGATCGTGCACGTGTCAAAACG
CAAGCCTATACGATCGTTCCCAGATCGTCCCACGCTGACGCTGGTGGTGGACGAAGGAGATCGTTTCGGCTTTGATGAGGCACTTTTGCCCGAAGACAGC
TGAGAAGGCGGTCTCGATGAGGACGAGTTCGGAGTGGAGAAGATCGTGGATATGTGATCAGGTCGATGTACGCGGTATGGTCGCGTCCATCGAGAATTTC
AGGTACGCTGGAAGGTTACGATCAGCTTTCGTGGGTTGATGTAGCCGATCTGAATTGCGGAGCTTTGTTGCGCGAATACGAGCGAGGAGTCACCAACCAA
AATAGCTTCGCTACGATGCAGTCGCACGAGGAGGAGGAGGAAAGCTCGTAGCAGGTTGGCTGTTGCGGGCGGAGGAGTGGTGTGAACAGTGTGCGAGGTG
GCCGTGGAAGTGTTTTATGTGATATTGTTGTGTAAATCGAGGACGACTGTTCTCGATCGGAGCGGGATGCTCGATAAGCAAGAAAATGATGAAGAACAAC
AACAAAAGGAGAAGCCGATGGATCATATTGAGAAGACATACGATCCACTAACTACCTCATCTTAGTCGGCAAAAGGAGAGAACTTGCCGGTGAGGTGGGA
CAGTTGGGAGCCCGGATGATCTTGAAGGTGACCGCGATACTGATTGCGCCACGGGTCAACCAGATCGACGGCACGTAGGGTGTCCACCAGGTTGGAAGGC
GGAGAGCTACAACCAAGTCCAGGGTACCAAACCCGTTGTTCGTCCGCCCGGGGATAATGCAGAAAGAAAGGGTCCAACAGGATATCCAAGTCGCAGTGCC
CAGCAATCATCCCTTGCAAGATCAACTTGAGGAAGCGTTTCTAGACGGCACCGAAATGGGATCGCCTCTGCTTGCGATCTTCCCAAAGCCGTGCCAGATA
AGCGTTCGATTTGCGAAGCGCGGAGCTGATCATGAACGCGTGAGTAGCCTCCCATAGAGCCTGCCGCTGATCATCTTCGATCTCCAAATACTTCCGAGAC
ATCGCCTCGAACCAACCAGTCACGTCAAAAGATAAGGGTTGGCACCAAGACGTTAAGAGAATTCCACAGCGTCGTCGCGTAAAGTACCGCAATAGTGTCC
TCGGTGATCAGACCGGGTGACCAAGCGCCGCGACAAGGCAATCGACTCTGCGGCGGAAAAAGCCTCGCTTCGCTAGGTGATGGAAGAGCAATTCGATATC
CATCTCCAAGACACTGACCCGGCTCATTGTGCTCACCGACCACGGACGAACGTCAGCTGCCGCCCTACGAACACGATCGCGATATCCAGGGATCCCGCTA
GCACGGGGAACGGTGAGACCATCAAGCTGATCCAGAGCAACTTGCGCGGTTCATCAGCTACGCTTCTGTCACTGTCATCGTCATGCCCGTCGCCACGATC
GGAATCACGTCGCGCAGTCGAATGGCTGTCCCCGCCATCATCACTCTCATCACCGGAAGAGGCACTACCAGGGTCATCTTCCAACTCTTCGAGTTAATCG
GGATCCTGGTTCGAAGCCTCCGAAGTACTTGATGACTCGATGTCGATGGGGCAGCAGGGTGACCTACCGCTAAGGCTACCGGTAGAAGACGAACGGCGAC
GACCGGACGATCGCGAACTTGCAAGAGCTGCCAGTAGAGAGTCGTTGTCACTACTGGGTGGAGAGGCACGAGCAGACAATGACTGCTGGAACTGAGAGCG
GTTGTCACCAGAGAGCCTGCCGGATTTAGGAGTTGACGGTCCCGAAGAAAAAAGAGATCGCGAAGCAGATCCACCGTGAGAAGGCGGAACAGTACTTGAT
TCCGACACTGGTTTAGGGGGTCGCTGTCACGGACGACTACGGGGCGGACTTGACCTGTCATACCACGCGGTCGCTTGATCGCCTTCTTGGATGCGGCAGG
CGTTGACTTAGAAGAGGAAGAAAGTGGTGCTGCGTCTTGCTCTGGTTGGATGAACGAGATCAACCCCGCCACCCTATTGCGGAGCTGATCGCGGTCTTGT
ATCGCACGGTCATGGTATCTTTTGAGTGCAGAAGATGCCGGCTGTGCGTTAGCTAAGTCAGCAAGGAGCAACTCGTTCTCGTGATTGAGCGTCTTGATGC
GACTATGATCTGCCTGCGACATTTTCAGACCACGCTCCAATCGAGCGATTGACGCCCGCGCGTTATCAACTTGGATCATCGATACCAAACATAGAAGAAT
AATGTTAGCGCCACGCGCGAAAGACTCATCGGACGTACGAGGCGGACTTACGAAGTGATCGGCGGTCAGCTAACGCCCGATGGCGATCAGTCATGATCTG
TTGCCGGTTGCTGGAAGTGGTCCGAAGCGTGGCCTCAACAGCCTCTGCACGAGAACGAAACTGTTCTCTCTCTGCGTCGATGCGATCGAAGTCCCGCTTG
GCTCGAGCTGTCTGTTGGGCCAGCTGTGCTTGAAGATTAGACACGCGCTGCTCGAGACGTTCGTTCTGACCGCGTAGTCGAGACGTCGCGTCCTCTAATG
CGCGCTGCGACGACTCAAGTGCGCCGAGTATCTTGTTGGCTTCGGCCAAATCCAAAGCGGCGCGGTCGCGATCTGCGATCGCCTGGTCCAACCCTTCCTG
TAACGTGGCGATACGACGTTCTGACCCCGGCGGCTGCTGTTTAGCCGCCGGAGACTCTACATTAGCCAGAGGACGAGTTAGCTCGCCGATCTCCGCTTGT
AATCGTGCTGTTTCCTCCGCGAGGACCTTCTCAGCGACGCGCAGACGATCCGGGACGGCCGCGATCTCGTGCAAATTGTCGAGACGCTCGCGCACCGCCT
CTTTGAAGTCAGCCGCCACCTGCTGGGTTTCTTGATAGCGCCGAACAGGAGATCTTATTGGTGCTGACAATGTAGCACATACGGCTGCGTATGCAGAGTT
CAGGTCAGCCTCCAATTGGTCAGCACGTGCCAGTTGGTCGCGATATGCACCGCGTGATCGTCGTCGAGATCAGATTGGGCCTCAATACGTTCCATCACGG
ACAAAAATATTGCGAGAGAGTTTCGGGCGGCGCCGAAGTCAACGCTAGGAAGCGCAACGCGAGCAGTGGAGACGACCGGAGCCTCAGAGATACGGCCAGC
GGATGTACCAGATGCAACAGCGGGAGGGTCTTCGGACGGCGCGTCAGTTGCTCCAGTCATGACTGTATCTAGCACGGAGGCTGGTGGTGGTTCAGAGAAG
GAAGCAGAATTGTTATGGAATGCGCTGAGACCAACCACCGTACGGTTGGTCGTAGAGCAGGGGGCGATTGAGGTGAAGTGACGTGGGTCAAACTGCCGAT
GATGGGAAGAGATCGCGTCTGGACTGATTGAACCAGAAGGGTTTGGGTTGGTGTCGGATATTTTCGGATGACCCCAGTACCTGACTTGGTACCACAACGA
GGCTACAGGTAATTATTTTTCCTGGTACCACCTTTTCGGTACAGTCGATCATCTTAACACCTGCGATCATCTGGACACCCGCGATCATCCGAACTCACCT
GATCAGATCGACATGGTACCACCCCGGTGGTACAGTTGAATTGGATTGACACTGGTTATGATGGTACTGGTTGCGAAAGAAGTATACTCCACGTGAGAGT
GGAGGGGAATATCGGAATGTTAACGGTAAACGTAAGCAGGCGCTCGGAGCTGTTTATCTTTCTTTTGTTCTTCCCCACTTTTCGAACAAGCGATGTTGTT
CTCAGGAATTCATGGTGATAGACTAGATGGTTCGTCCACTTATTCTGGGGACAGATTTCCTACAACAACAAGAGATTGTGATTGATTATCGGAAGGAAGT
TATTCCATGGGACGGAATGGAGCTAGTCATGGAAACTAAATCGAGGCCAGAAAAACGGGTAGCATTTGCATTATCAAGCAAAGAGGACCGCACTTTACGC
ATCCTGGATGTGACGGACAAAGAATTCGATCTAAATGCGTTAGTGCTGAAAGAACATTTGAAACCTGAACAAAAAACAACGTCTCCTGGCACTACTTGAA
ACATTTAGGATGGTGTTTCTGTGGGAAATCGGCAAAATGAAGTTGCCGCAGTATAAACTGCCAATTAGACCGGGTAGTCAATCAAGCGCACAGAAGTCAT
ATTCCATTCTATTGATTTACAAGGATGGTACTTTACGCGAAGTAGAGAGATTGGTGAAGCTTGGAGTATTGGAAATAGACAAAGATTCACCATGGGCTGC
ACCAGCATTTATTATTCCCAAGAAAGATGGCATCATACGATTTTTATCGGACTTTCGACGTCTTATTCTTTGCATGGAGCGACGATATTATCCGCTGCCT
CGGATTCAAGATGTGATCCGGGAACTACCAAACCAGCGTTTGTGACAGCGCTAGATTTGGTAATGGGCTACTACAGTCGCGAATTATCTGAAGAAAGCCG
GTCATGTACTCCCCTGGGGGAAGTATCGATATTGCCGGTTGCCGATGAGAATTAGTACCGCGCCTGACGAATTCCATGCTGTAATGCAACAGTTATTAGG
AGATTTGGTATCTGTGAGAGTGTACTTTGATGATGTTCTAGTGTTTTCAAACACTTTTGATGAACATTTGCAGCATTTGCAAGTGGTACTTCAGCGACTC
AAAGAGATGTGGGAGTAGTGGTTCACTCGACAAAGAGCAAATTCTGCATGAAAAAGGTTGAATATATTGGGTTCCAAATTAGCACAGGAGGAAAACAACC
GATGAAAAGAAAGGTCGAAGCTATTGCGCGTCTTTTGCGGCCATGCACTATCCGTGATCTCCGACGGTTCCTCGGGATGATTAATTATTGGAAGTATATG
TGGCGTGAACGGTCAGAAGTTCTTGC