Description :
From Genome Similarity Track
Location :
contig_37:10739- 17664
Transcript NameFunction/comments
g7553.t1hypothetical protein

Sequence
6925 bases(100 bases per row)
CGATTTGCAGAGGATTGTAGACGTAGACGCAGAAGCGAAGGTTAGTGGCGAGTGAAGTGAAGTGATTGAGCACTAGAATGAAAATTGGAAAGTGATTGAA
TGTGAGAGGTGGGAAAAATCAAACACACTGACTGCTGCTGCTTTTCCTATGCTACTGCTGTCCTACATGCACACCACGGCGCCCTTGTGTGTGCTCTTGT
TCCTTCTCATCTTGCTCAATGATGGCTCGATGTACAGATGGCGCGATGCCTGACTTCAGCTTGCAACGCCGCGCCGCTGACACTCCGATGACTGACCCTG
ATGTACCACCACGATGCTTGACAACATTCTTTGCCTTAGTCGCCGTGAGCATTTAACACTAATTCGTCGTCAGCATTTAACAGCTTCGATCTGCTGTCCA
CTATGGACAGGGGCGAATCGTGATCTGCGGCGATTCCAATCTGATAATCCGCCAGATGCGTGGCGAGATCGCGTGCAAGGCTTCTGGCCTGTTGTTGCTG
GTCAAAAGGTGATGGATCAACTTAGATCGTGGTCAAAACACGAGTTCCTACAGATGAAACGAGACCGGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGC
TCTCCAAGGGGGCAAAGGGATCGTAATCACCTCAGACAAAGATCATCAAGACTTGATCACGCTCAACCGCTTGGACGATCTCCTCAAGGCGAGGGACGAC
GATACCATCGTCCGTGACCAGATCAACGCGACGCAGACGACTGACGCTGAAGTCCTGCAGGAAGCGATTGTACAGCGCATACGCGGTGAACGAATCATCC
AAGCGCAGAACGAAGAGAAGTGGATCATCGATCTGAAAGCGTACCTGAAAGGGAACGTCGGGGTCTAACCGCGGCCGAAGCTAAATCGTGCGCCAAGGTC
GCGAACGACTATGAGCTGGACGAAAACGATCTGCTGTTCATTGCCCGTCAGCCATGAGGCAGGACGAGGATCGAGACGAGATCGCGAAGCTGGTGGTGCC
TGAACCCTGCAGCAAGATCTCTTCACGATTACCACGCAGGGGGGCATCAAGGATCGGAAGACGTACCGACGAATCCATCACACTTCCACTGAGGGGCTTG
TACCGAAGTGTCAGCGCTATGTGGGAGAATGTACAGATTGAGAGACAGGGAAAGGTCGACCCTTCGTGAGAGGAGAATCCCCTGGGAACGTGCAAGCGAC
GTACCCGTTTCAGATCATCGTTATGGATCACATTCCGTCGTTGCCCAAGTCCTTCAAAGGCAATACGGAGCTGTTGATCTGGGTAGACCTGTTCTCGGGT
TATGTGATCGCTAAAGCGAGCGTCAAGAACAGCGCAGATGATTGCGGAGAACTACGAGGAATGCGTCTTCCGACGTTTTAGAGCCAGTGAGGCTACCGGG
AACCCGGGTTTGTCTGATTTTTTCGTGCTTTTAGCAGGATAGTGAGACAGAAACAGTGGGCCATTATGACTTACGACCACAGGTCAATGGGACGACAGAA
CGGATGGTAAAACATTGACACGCGCGCTGAAGATTCATGTCGCAGACGTCAACCAGCAGGATGAGTACGCGGAGCGATTACGTTTGCGCTCAACACGTCA
CAGAATCGGGTTCGAGGAGATACGCCGTTCTACTTGACACGGATGGGACCTGCGATCTGCGTTAGAGACGTCGCTACCTCTCGGAAGTACGCGCCGACGT
GATCGTGACCCGCGTCGGTGGTGATATCATATACAGAGCCACTATCGTCAGCCAGAGAGAGGTTAACGAGTCCCTGAGGGAGCCATCCAAGGGCGAGAGA
TGGCATAACGATCAGGTCCGACCTCATGGTATCGAGGCCAATATGCAAGTGTGGCTGTACCTAGATCGCGTGAAGGAGGGCTATGCACGCAAATTAGCCC
ACATGTGGCACGGACCGTTCAGGGTGATCGAGATGCTTGACAATCATGCAGCAAGGTTGGAAGTCGCTGGCACCAAATACGGTTATTCCCGATCGTCATG
TGTCAAAACTCAAGCCTGTGCGATCGTTCCCAGATCGTCCCACGCTGACGCTGGTGGTGGACGAAGAGATCGTTTCGGCTTTGATGAGGCACTTTTGCCC
GAAGACAGCTGGAAGGCGGTCTCGATGAGGACGAGTTCGAGTGGAGAAGATCGTGATATGTGATCAGGTCGACGTACGCGGTATGGTCGCGTCCATCGAG
AATTTCAGGTGCGCTGGAAGGTTACGATCAGCTTTCGTGGGTTGATGAGCCGATCTGAATTGCGGAGCCTTGTTGCGCGAGTACGAGCGAGGAGTCACCA
ACCAATCGCTTCGCTACGATGCAGTCGCACGAGGAGGAGGAGGAAAGCTCGTAGCAGGTTGGCTGTTGCGGCGGAGGAGTGGTGTGAACAGTGTGCGAGG
TGGCGCGTGGAAGGTTTTATGTGATATTGTTGTGTAGATCGAGGACGACTGTTCTCGATCGGAGCGGGATGCTCGATAAGCAAGAAAATGATGAAGCAAC
AACAAAGGAGAAGCCGTGGATCATATTGAGAAGATATACGATCCACTAACTACCTCATCTTAGTCGGCGACAGGAGAGAATTTGCCGGTGAGGCGGGAGT
TGGGAGCCCGGATGATCTTGAAGGTGGCCGCGATACTGATTGCGCCACGGGTCAACCAGATCGACGGCACGTAGGGTCCACCAGGTTGGAGGCGGAGAGC
TACAACCAAGTCCAGGGTACCAAACCCGTTGTTCGTGCGCCCGGGGATAATGCAGAAAGAAAGGGTCCAGCAGAATATCCAAGTCGCAGTGCCCTGCAAT
CATCCCTTGCAAGATCAACTTGAGGAAGCGTTTCCAGACGGCACCGAAATGGGATCGTCTCTGCTTGCGATCTTCCCAAAGCCGTGCCAGATGCGTTCGA
TTTACGAAGCGCGGAGCTGATCATGAACGCGTGCGTAGCCTCCCATAGAGCCTGCCGGTGATCATCTTCAATTCCAATACTTCCGAGACATCGCCTCGAA
CCAACCAGTCACCTCAAAAGATAAGGGTCACCAAGACGTTAGAGAATTCCACGCGTCGTCGCGTAAAGTGCCGCAATGTGTCTCGGTGATCAGACCGGGT
GACCAAGCGCCGCGACAGGCATCGACTCTGCGGCGGAAAAAGCCTCGCTTCGCTAGGTGATGGAAGAGCAATTCGATATCCATCTCCAAGACACTGACCC
GGCTCATTGTGCTCACCGACCACGGGCGAACGTCAGCTGCCGCCCTACGAAACGATCGCGATATCCAGGGATCCAGCTAGCACGGGGAACGGTGAGACCA
TCAAGCTGATCCAGAGCAACTTGCGCGGTTCATCAGCTACGCTTCTGTCACTGTCATCGTCATGCCGTCGCCACGATCGGAATCACGTCGCGCAGTCGAA
TGGCTGTCCGCCATCATCACTCTCATCACCGGAAGAGGCACTACCAGGGTCATCTTCCAACTCTTCGAGTTAATCGGATCCTGGTTCGAAGCCTCCGAAG
TACTTGATGACTCGATGTCGATGGGGCAGCAGGGTGACCTACCGCTAAGGCTACCGGTAGAAGACGAACGGCGACGACCGGACGATCGCGAACTTGCAAG
AGCTGCCAGTAGAGAGTCGTTGTCACTACTGGTGGAGAGGCACGAGCAGACAATGACTGCTGGAACTGAGAGCGGTTGTCACCAGAGAGCCTGCCGGATT
AGGAGTTGACGGTCCCGAAGAAAAAGAGATCGCGAAGCAGATCCACCGTGAGAAGGCGGAACAGTACTTGATTCCGACACTGGTTTAGGGGTCGCTGTCG
CGGACGACTACGGGGCGGACTTGACTGTCATACCACGCGGTCGCTTGATCGCCTTCTTGGATGCGGCAGGCGTTGACTTAGAAGAGGAAGAAAGTGGTGC
TGCGTCTTGCTCTGGTTGGATGAACGAGATCAACCCCGCCACCCTATTGCGGAGCTGATCGCGGTCTTGTATCGCACGGTCATGGTATCTTTTGAGTGCA
GAAGATGCCGGCTGTGCGTTAGCTAAGTCAGCAAGGAGCAACTCGTTCTCGTGATTGAGCGTCTTGATGCGACTATGATCTGCCTGCGACATTTTCAGAC
CACGCTCCAATCGAGCGATTGACGCCCGCGCGTTATCAACTTGGATCATCGATACCAAACATAGAAGAATAATGTTAGCGCCACGCGCGAAAGACTCATC
GGACGTACGAGGCGGACTTACGAAGTGATCGGCGGTCAGCTAACGCCGATGGCGATCAGTCATGATCTGTTGCCGGTTGCTGGAAGTGGTCCGAAGCGTG
GCCTCAACAGCCTCTGCACGAGAACGAAACTGTTCTCTCTCTGCGTCGATGCGATCGAAGTCCCGCTTGGCTCGAGCTGTCTGTTGGCCAGCTGTGCTTG
AAGATTAGACACGCGCTGCTCGAGACGTTCGTTCTGACCGCGTAGTCGAGACGTCGCGTCCTCTAATGCGCGCTGCGACGACTCAAGTGCGCCGAGTATC
TTGTTGGCTTCGGCCAAATCCAAAGCGGCGCGGTCGCGATCTGCGATCGCCTGGTCCAACCCTTCCTGTAACGTGGCGATACGACGTTCTGACCCCGGCG
GCTGCTGTTTAGCCGCCGGAGACTCTACATTAGCCAGAGGACGAGTTAGCTCGCCGATCTCCGCTTGTAATCGTGCTGTTTCCTCCGCGAGGACCTTCTC
AGCGACGCGCAGACGATCCGGGACGGCCGCGATCTCGTGCAAATTGTCGAGACGCTCGCGCACCGCCTCTTTGAAGTCAGCCGCCACCTGCTGGGTTTCT
TGATAGCGCCGAACAGGAGATCTTATTGGTGCTGACAATGTAGCACATACGGCTGCGTATGCAGAGTTCAGGTCAGCCTCCAATTGGTCAGCACGTGCCA
GTTGGTCGCGATATGCACCGCGTGATCGTCGTCGAGATCAGATTGGGCCTCAATACGTTCCATCACGGACAAAATATTGCGAGAGAGTTTCGGGCGGCGC
CGAAGTCAACGCTAGGAAGCGCAACGCGAGCAGTGGAGACGACCGGAGCCTCAGAGATACGGCCAGCGGATGTACCAGATGCAACAGCGGGAGGGTCTTC
GGACGGCGCGTCAGTTGCTCCAGTCATGACTGTATCTAGCACGGAGGCTGGTGGTGGTTCAGAGAAGGAAGCAGAATTGTTATGGAATGCGCTGAGACCA
ACCACCGTACGGTTGGTCGTAGAGCAGGGGGCGATTGAGGTGAAGTGACGTGGGTCAAACTGCCGATGATGGGAAGAGATCGCGTCTGGACTGATTGAAC
CAGAAGGGTTTGGGTTGGTGTCGGATATTTTCGGATGACCCCAGTACCTGACTTGGTACCACAACGAGGCTACAGGTAATTATTTTTCCTGGTACCACCT
TTTCGGTACAGTCGATCATCTTAACACCTGCGATCATCTGGACACCCGCGATCATCCGAACTCACCTGATCAGATCGACATGGTACCACCCCGGTGGTAC
AGTTGAATTGGATTGACACTGGTTATGATGGTACTGGTTGCGAAAGAAGTATACTCCACGTGAGAGTGGAGGGGAATATCGGAATGTTAACGGTAAACGT
AAGCGGCGCTCGGAGCTGTTTATCTTTCTTTTGTTCTTCCCCACTTTTCGAACAAGCGATGTTGTTCTCAGGAATTCATGGTGATAGACTAGATGGTTCG
TCCTTATTCTGGGGACAGATTTCCTACAACAACAAGAGATTGTGATTGATTATCGGAAGGAAGTTATTCCATGGGACGGAATGGAGCTAGTCATGGAAAC
TAAATCGAGGCCAGAAAAACGGGTAGCATTTGCATTATCAAGCAAAGAGGACCGCACTTTACGCATCCTGGATGTGACGGACAAAGAATTCGATCTAAAT
GCGTTAGTGCTGAAAGAACATTTGAAACCTGAACAAAAACAACGTCTCCTGGCACTACTTGAAACATTTAGGATGGTGTTTCTGTGGGAAATCGGCAAAA
TGAAGTTGCCGCAGTATAAACTGCCAATTAGACCGGGTAGTCAATCAAGCGCACAGAAGTCATATTCCATTCTATTGATTTACAAGGATGGTACTTTACG
CGAAGTAGAGAGATTGGTGAAGCTTGGAGTATTGGAAATAGACAAAGATTCACCATGGGCTGCACCAGCATTTATTATTCCAAGAAAGATGGCATCATAC
GATTTTTATCGGACTTTCGACGTCTTATTCTTTGCATGGAGCGACGATATTATCCGCTGCCTCGGATTCAAGATGTGATCCGGGAACTACCAAACCAGCG
TTTGTGACAGCGCTAGATTGGTAATGGGCTACTACAGTCGCGAATTATCTGAAGAAAGCCGGTCATGTACTCCCCTGGGGGAAGTATCGATATTGCCGGT
TGCCGATGAGAATTAGTACCGCGCCTGACGAATTCCATGCTGTAATGCAACAGTTATTAGGAGATTTGGTATCTGTGAGAGTGTACTTTGATGATGTTCT
AGTGTTTTCAAACACTTTTGATGAACATTTGCAGCATTTGCAAGTGGTACTTCAGCGACTCAAAGAGATGTGGGAGTAGTGGTTCACTCGACAAAGAGCA
AATTCTGCATGAAAAAGGTTGAATATATTGGGTTCCAAATTAGCACAGGAGGAAAACAACCGATGAAAAGAAAGGTCGAAGCTATTGCGCGTCTTTTGCG
GCCATGCACTATCCGTGATCTCCGACGGTTCCTCGGGATGATTAATTATTGGAAGTATATGTGGCGTGAACGGTCAGAAGTTCTTGCTCCTTTGACGGAA
TTGACTTCAAGCAAGCGGCCTTTCCAATGGGGAACCATTCAAGAACAGGCTGTGATCAAGCAATATAATGATAATACAGCAAGTGCAGCTCGTGTATCCA
AACTACAACCAAGTGTTTGATATCT