Description :
From Genome Similarity Track
Location :
contig_3:1073899- 1075275
Transcript NameFunction/comments
g1211.t1RAW35421.1 hypothetical protein PC110_g8286 [Phytophthora cactorum

Sequence
1376 bases(100 bases per row)
CGGCGGCGAGGCACGCCGTGTAGTCTTCGGGCGTGGACCACCACAGCATGGAGCAGAGGTACCAGGTGAGGCAGACCGAGTCCTCGCACGCGTTTTGCAG
GTACGACTGCGCCTGCGAGTTGTAGTAGTACTGCTCCACCAACGCCGAGTCGGTTGCGGCGCTCACGATGAAGCGGTTCATCTCCGACCACGACAGCGAG
CTCACGTTGTACGCGGTGCTGGCCTTGAAGAGCGGCTGCCAGTCGAGAGCTGTGCTATTGTCTTCGGAGATGTTGGTGCCGTAGACTGTGAAGTCCAGCA
GGTCGTACGTGGTGGCGTCAAAGTCCCAGACCATGAACGCTGGGTTGTTGTAGAAGATCGGCGAGATGGCTGCCGACATGAACAGAGGCACGAGCGCTGA
GCTCTCGGAGCTGGCATCCACTGCAATGACGTCTTCAGGGCTCTGGGACTCCATGTCGGCGGTGAGCGGCAGGCGGAATTCGACGCTATGTGTGTGGCCA
AAGATCTGAGCCTTGACGACATCCGCGTACTCCGTCACGATGTTCTTGTACGCATCGATGTACGAGGCCTCCCACATTGGTGAGCCGTCCTGGGCATCGA
TGATCGGTGGGATGTGGCCGGCGATATACGCGAACTTGTTGCCGTTGCGAAGTCCCGCCAGTGTGGCGTTCAACCAGGCGAACTGAGCAAATGGATCGGT
CTCATTCGATGTGTCTGGGGTATGCTTTGGCTGCACAGCTCAAAAACAGCAGCGTTAGCTGGTTGCGAGTGGCAAAAGACGTACAAGACTGCAGGGGCAC
TCACCGAGTAAGGAACGGTGTTGAGAGTGAGCAACAACAGGTTCTCGTCAAGCTGGTACGACAGGTAGCCGCGGGTGTTGAGGTCCTTGAGATTGGATGC
AGTAAGCGAGTCGTTCCACGCCGGAGACACGACCTCGATCGTCGGGTTCTCCTCAGTGGTCGGGTCGGTGATATTCATCGTGTAGTCTGTGTTAGCAACA
ATGGCACCAGAGTCGGTCAGTTAAAAGTTGGTCAGCAGGTAAGAACAGACAACGTACTCTTCGTGTCGGTGTCGCCCAGGATGGCAGTGGCATTGAGAGT
CTCGTTGCTTGAGCCGGAGAAGTACTGGGCCATCGTCTCCACATTCACCTTGACTGCCTCGGCGAGATACTCGTCTGATGGTGTGTCATGCACGGCATGG
TCACCAGTGTAGAGGAAGAAGTCTGGGTTGGGCAACACCTGCTGAGCGTACTCGAGCGCCGAGACCAGCAGGCTGATAGGAGCATCGTAGCCGTACTCGA
CTGGAATCTCGGCGGATTCATTTGCGTCCAGGGTCTCGGAGATGTTGAGGTGGACGTCGGAGAAGTGCAGGATGTG