Description :
From Genome Similarity Track
Location :
Scaffold_81:107388- 114105
Transcript NameFunction/comments
Phyca_LT1534511330chaperone clpB putative
Phyca_LT1534511334conserved unknown protein
Phyca_LT1534537271predicted zinc finger protein
Phyca_LT1534129113Avh150

Sequence
6717 bases(100 bases per row)
tcgctctgggagaagtacctgacagcttaaaagacaagaaagtggtggctctggacttggctgcgctcgtcgctggagcgaaatttcgaggagaatttga
agaaagactgaaatccgtacttaaagatgtggatgaaagtgacgggaaggtgattctgttcattgacgagctccacacattagtaggggctggtggcaat
gaaggatcaacggatgctgctaatatgctcaagcctgcattggctagaggtgcactgcattgcatgggagcgacgactttagacgagtacaggaagtaca
ttgagaaggatgcagctttagccagaaggttccagccggtgttaatctccgagccaagtgtggaagatacggtgacaattctgcgaggattaaaggagaa
atatgaagtgcatcatggtgtgaggatcgctgatagtgctttggtggctgctgccacgctggccaacaggtacctgacggagaggaagatgccggataaa
gctattgatttaatggacgaggcggcgtcgagactgcgtctacaacaggaaagcaaaccggagccaattgagaaattggaccgtgagattattctgagac
gaattgagattgaagctctacggaaggagacggactccgcttcgaagaaacgactggctgtattggaggaagaggtgaagaaagcgtcggaggagctacg
tgcgttgatggacgagtggaacgccgagaagcacaagctggaggagatgcaggacgccaagcgtcagttggaagaagctcgtcgagatctggtggcggcg
cagaattccggtaactacgcaaaggcgggagagctgatgcactcgaccattccgaagctggaggcggcagtagctcatgaggagcaggaggaagaagaga
cgaaaagggcagggaagagcaggacgtcacttggagacgcagtgacagctgaccatgtagcggaggtggtagctcagaccactggcatcccagcggctac
tttaatggaaggcgaaaagcaacgtctgctcaagatggaagaccacatcaaccagcatgtgatcggccaggaggatgctgtcaaggccgtcagcaactgc
gttcgtctcgcacgtgctgggcttcacgcacacaaccgtccgcttggagtgttcatgtttttggggccaacgggtgtgggcaagacggagctgacgaaat
ctctgtctgagttcctgttccagacgccgcaagcgctcacacgcatcgatatgtccgagtacatggagaaatttagcgtcagtcgtctcgtgggtgctcc
tccaggatacgtcgggttcgaggagggaggaactcttacggaagctgtgcgtcgtcgtccgtatcaagtggttcttttcgacgagttcgagaaggcgcat
cgagatgtgagcaacatcctgcttcaagtgctcgatgaaggccggctaacggactcccaaggccgcctcgtggacttccgcaacactgtcatcatcctta
cgagcaacttaggctcggagatccttgctgggcttcccgaaggagctcccagttcattggctgagaacgacgtgatgaatgttgtacgctcccattacgc
tcctgaattcctgaaccgaattgacgagttggtgttgtttaaccgtctgaaacgcgaggacattcgctccattgctgaccttcagttgcgtcaagtggac
aagctgctcgaggagaaggaattgactatgcaggttgatccagaagcggaggactggctggctgacgctggatacagtccactttacggagctcgtcctc
tcaagcgtctcatccagcagtacctgctcaacccgatggctgtaaagttactggaaggttctgcttctccgggccaagtgctgcatgttaaggcgaatcc
caagtacgaggaagaagttctgaaagatgccaaggccgccaagccgcttctcatttctgtcgagtaggtgagcggagatgctttttgtacatgtataaca
agacaattttgttcagaaaaagtttagttttaaatttaaggatattagtggcatatcctagcaagtacctgtgttctcaatgcgcgtggttgcatgtttt
gcacttcttgttccacacttgcgtcgtgtgggcctggaacatggggcaattgcacagtctgcacgctcccatgactgaagagcgacgttgctgctcttcc
ttgtggtcctcaatcccacgcatggcattgtcaattgcctcgtagagagggcgagcggctgccggctgctctacgaagccattcaagagatcactcggct
gcacgtcccgtccgtaaaacttgcggttcagatctgagcgcgtcgcgagaattgctccctgcagggaaatgccagcaaacagtcccttactctgcgagta
actgtagttggcgttgaggccgctggtgctggcagcagctgcagcctgtgccgatcggccgtagggacccaccgcaacatccagacccgctccgaggttc
acttgaggcttgtggaacaccttgacagctccttccgatccgagaataatcatcacttccaccaattcaccacccagttcgaagccaccacttaatccga
acgtaccaatggctgaaggagctgaccatgacccatcaggtagtttggcaacaaccagacccgtgccaattttgccagagatgaggaaaccagctttaac
gaccgtcatgattgctagtccatgggctttctgcaggatcgcaacgggaatcgctcggtctgctgacgcgccccagtcattccggaagaaattgccgata
atatcagcagcattgcagcactctttgttcaacgagttggtaaatggcacgtgcaagcgcccacgagcttcgtggacattgtcagtctgcgattgggcgt
acgtagccaccagctcgtcctgtagcgggtggagacctggagcacattggatgcacacacgttgaggcactgacgggtcgtaattcttcgctccttcaat
ctgcttcccaggaggcaccagcagtcgaacaggagagcacgaactgcacacgaacagtccacaagtacgactgcaagtaaaataaaacaaaatgttagta
aaaaaaaagtaaaataatacctgctctccgtaccattgatgacgtctcttggtcacatcaaagcggacgttgcacacgtcgcagttgggatgatcagcgt
agcggttgttgagaattcccttgctctgcggcgcctgattggagctcatcgagtcactacggaacgaatcggccatactagggttcctgttggcaaaagc
tgattgccgtccatcactgctcccattgctactgccagagctaaaagcccgtgctcgttgttgtgcgttgtagtccaccagttccttgcgtcgatcatca
tccggtactaatctggccaatgtgggcacgaagctcctggttccttcttgtcccaattccgccactaaagaggcgtaaaaagactgcacatccatctctt
tcaggccgtatttccggcagttttgcttaaaatccttgactccacgttcgttattacctcctctcgaagctcggatcgtactcacacatctctcatagta
ttgttgagcttcagctccagtggcagcaggtggtacagggtccgaagcgactggaatggcagtagggggagaattattgccattattgaaactattgcgg
aaggcactagggacggatttccgaacgtaaggagctggaggaggaggaggaggaggaggttgtgactgggacccattgaagctgctcttgagaggattgt
gctggaacgaattgcctccatagggggaattctcactgcgaaaggccgaggctacagctgtagcagccccttgatacgcagcgactgggacagcaggggg
agcgccgccattgaacgaagaagagccgccattgaaggaagaagagagggaagtgctgctgtcgtcggtgaagcgcgtgccacactcggagcagaatttg
cctccgttgctctgagcgccacattcggcgcagaactttggcattttgcacgagtctttttcgatactgacgtggggacctctttgagggaaatgtggcg
taatccgtgtcgcagaatagagcgaggttttaagtggcgaattaaacgagttgctggatacaaggctgagagaaacggagtaacttgctacgagttagag
agtgaattaaacgggctgattcgatgttccaccctctggcaaaaagtgcctcaagcaatcgccaatcactgcgtgggttcacttttgcagcaggatgtac
gttggcttaaacctttcaggtaccggtaagggtgttcaggtcctgccagcgagaatccagaaccccgtaataatggtcgctatacatgtacatttactgt
atgtagtacttgtgtgatgcaggtggattttcaaccggacgtcgaacaagtcaaacggaggttgggacactttcaaagtgatacgtatacatggtacctt
caattgacaagcatgctggcccaatgctggcagcagtgatattaataccgtagtggcaactactggttgcagaacatgccgcaagggaatactagtaaat
taaacgctgttcactttcatgtagaggtaagttcaggcacttatcaatgtacacgtatgcatacgtgtgtcaactctacatgtacatgtacatgtacagt
cttctaactgtagaagcgataacaaaacgagtcaaatctaccagtttaatatttttaaaacttgtaataccaaaatattattataccaaacagtataata
ctattgtttgttctagtaatactactattttcattatatttttgtagaggcaataaaatagtatagtttagtattactgctacaaaatttgttttgctct
tctgaatcttacggaattttggtaccgaatgtttgtgacacaccaaatccccatcaatgaaattgcacaaatactgggtgaaaataccggtaaatggaaa
taactcagtacaggtaaggtaaagttattcgatgttcttaccctatgaaatgctaaccatgttgataacaccgaaagaaaccgccaattacatgacatgt
acattgtacatgttcattggactcgacgttttcaattaaaaaatacattagaaaagtgtattagtctacttattgaaagctcttgctacgtcttgtcctt
ctgcgttggaggcacacacagctgttggtttcaccatcaagggatgaaatacggagcgagtaaattctttgtgctttgaaggggggcaaacgagtgtgag
gatgttcactgtgaacttcacagtgtgctttcgtccactgactcagtggcactgaagaaggtggcgctgcttggtgccgcaatgcatctccaaatcgcgc
tgtttctggttgtagtctcccttctcgtcaatgttgaagcggtgccagcaaaagcccaatccgattctgttgtctcttttcgacacatcggacggctact
acgagacgagagggaggagagaggagtcagtgcaaatgccgtggaaacaatcaccgacgctgtggagtctaaaatcaacactgcacaactcaaaagctgg
ctggagagtggagaatccgccgacgacgtgtttaaactgctgaaactcgacagcgcagcggataaagtcctgggccatgcgaaactggacgaatggatcg
aatacatgaagcttttcaacggtcaaaaaggcagcaagaaaacgactttgatcaagactctgacggctcactttgaagatgatggggtggcaaggatgat
ccaaaaggcgttgcaggtcgattcaactgctaaaatggcaaaacgtttgcaattcgagcagattcaacggtggttgggtcacgagaagaccccagaggaa
gttttaaccctgctgaaactggatatcaatcggtatgatctctttgaaaaaccggaactgctcacctgggtcaagtacttggacgactggaacaagatgt
atccagacagacagacgactctttttgccagaatttcccctcttctggaggaaggaattctagcaaatttgctgataaaagccaaaagtgtggctagtac
cgagaaaatcgccttacggattcaagccgagcagactgcgtcatggcttaaagcggagaagacaccggacgatttattcactttattgagactcaacaga
gctgaagattcgcccctgctagagaacccaatcttcgacgcttgggtgaaatacgccgacgattttcgagaaatgtaccccaaagttagttttgatccca
ttgccacgatctcggagcattacactgctgcgcaagtggcgacgatgatcgttgaagcttccaagtctcctagcacatccagtatcgcccaccggttgaa
tactgaacagttccgggactggctcaacactcgtcagtcccctgtacgcgttttcaaactgctcaaattggacgaagcgggcgataaattgttccagagt
cctgtgatcaccacgtggctgaattacgcgactttttacaacacgaaaagggaaaaagtgagtatcacgacgttgctcaggaaacgctttggcgacgagg
ttctcgctggaattttaacagaagcccagcaagttccagcgacaaaagaagaagcgacgaaactattaacttcactggttggcagatggcccaagagtcg
agtacatccggataatg