Description :
From Genome Similarity Track
Location :
Scaffold_41:107383- 119775
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14712phosphopantothenoylcysteine decarboxylase
Phypa_INRA-310PPTG_14713octanoyltransferase
Phypa_INRA-310PPTG_14714separin
Phypa_INRA-310PPTG_14715hypothetical protein
Phypa_INRA-310PPTG_14716hypothetical protein

Sequence
12392 bases(100 bases per row)
GGCGACAGTCAAGGTGCCGGAGATCGCTGTGCGGCTATCGGAGACGGCAGAGGTGGCTTTAAAGAGTGGAAAGTTGCTCCTCCGATGCTGAAGTTGTTGT
GTTAAGAGCAGGTGTGTGTGGTGCTCACCAAGTCGGCGGATTTCTTTCTTCAACGTGCCAAGGACTACAACGAAGCGGCCTGGGAGGAGTTCCATGCAGC
AACGCAATTGTCTGGTGGTGGTAAAGGCAGAATTGTTGTCGTTCGAGACGAAGACGAATGGGAGGGATGGAACGTCGTAGGGGACAGCGTGCGCCACATT
GAGGTGCGTCGGGAGCGAAGTGGCGGTGATAATTACACTAACGCGCGAACCCCTATCGCTCTGTGTGCGCGTTTAACTTTGCTGCAGCTGAAGGACTGGG
CAGATGTGATGCTACTGGCACCAATGTCGGCGAACACGCTAGCGAAGCTCGCGAATGGCTTGGCTGACAACCTCCTCGTACGTTCTTGAGCTCGTTATTG
GGTGCATTTTTGACGTGATGTTTGTGGTATTACATGGACAGACCTGCGTCGCTCGGGCGTGGATCATGACCAAGCCTTTCATCTACGCTCCTGCCATGAA
CACGGACATGTGGAACCACCCGATCACTGCACAACAGATTCGAGTGCTGGACGAGTTTGGGTACAAGATGGTTCCTCCAATCGAGAAGAAATTGGCCTGC
GGAGTTGTTGGTACGAACGAAGTTCACTTGGTTCTCTATTCACATTTACTGCAAACCTCCTGACCTTAATGTGCTTCACACAGGCAACGGAGGCCTTGCA
ACAGTCGACAGCATCGTCGCCTTCACACTCGACCAGCTGCATCAAGTATCTCGCGTCGAATAGATCAAAAGGGAAACAGCATCAAAATACAGGTATATGC
ACTCTACAGCGGCGTCTTGGCCTCAACATCTTCCATATCGAGGTGGAAGACCTCGCTGATGGCCTCACTTGCAGCATCCTGTACATCCTTAATGGTCGCA
TCTGGACGAATGCGCTCGATACTCGTGACAGCGCGGTCGTCAATACCACACGGAATAATACGATCGAACCCGCGCAGATCCGTCGTAACGTTAAGAGCGA
AGCCGTGCATGGTCACCCAGCGACTCGCATGCGTACCTACCGCACAGATCTTGCGCATTTCACGCTCGTAGTTCCCCTTGCGATGCTCTCCATCCTCATA
TCCCTGCTTCTCCTCCACCCACACACCCGTTAGTCCGTCCACGCGCTCACCCTGAATGTCAAACTTGGCCAGTGTGCGAATCACCACCTCCTCCACCTGG
CGGAGGTACCAATGCAGGTCTTTCTTGTGTTGCGTCAGATCCAGTATCGGGTATACCACAACCTGTCCGGGGCCATGGTACGTAACTTCACCGCCGCGAT
CTACGCGAACCAGCTTGACATGCTCCTTTTCCGGATCAAACTTGACGTTCTCCATGGTGCCTCCACGACCCAGTGTGTATACATCCGGGTGTTCCAGAAT
AAGAACCACATCCTTCTCCACCGATTGGCCGGCGCGAATGGCCAGAACACGCTGCTGGATGAGTTGTTTCTGCCAGTCCCATGCGGTCTCGTATTCGACG
CTGCCCAAACGATACGCGACGCACTTGCGCTGCAGCTGCGGCGTCTCCAGCGCCGCCGCCTCGGTGGACAAGAAGCGCGCCAATGTGGCTCCAGTAGGCA
AGCATCGCTGATGTCTTGTAATCGACAAGGCTGTGGCCAGCGCGCTCTTCCACCCATTGCGCATCCCTATCATTCAAGTCGGCGAATAGTTGTGCACTAC
AGCGCTAAGTTCGCATTTCACGCGAACTTTACTGGAACTTAACTGGAAAACTCCCATTCAAAAAAAAATGCGAGGGAATGCGAAGGTTGGCGCCACCCGT
GACCAACTTCTTGCGCTCGTCCAGCGGCGTGGAGCAGCGCACAGAGCGCTCACTCTCTTCACACCTCAAGCAGCAGCTCTCGTACGCAATGTCAGCGCAA
CAAACTCGTCTTCAACGACTCTCTCCTTGCTGAAAGCGGCGGTCGAGCGCCGTGTGCCAGATTGGACCCAATCACTGACTCAAGAGAGGGATGCCAAACG
TCAACGCGTAAGCAGCAGCAGCAAGACCGACGTTGTGTTCGCGGCCAAGATGGCACAGAGCCTTGTGAAAGTTTACGCGGTCACCAGTGGCGCTGTAGCC
AAGGAAGAAGGTCAATAGACGCACATGTTTATGTTGATGGAAACGAAGTATTGACGATGTTATTTCTTTATGATGCAGAACTGGACGATCTGGTTGCGGC
GATGGATCTGGCGTGTGTGGCGCTATATGTTGTATGTGCACTGGAGCATGCGGTGCGGCTGGGAGATCTCGTGGTGGACAATCTGCTCTACCAAATTGCC
AAGAAATATGCGGATATTCCGAAGGTGGGTGGGGTTGCATACTGACGGTTCATGTGACTGGGTATTCAATTAACGGTTCGTTGGATGTTGGGCAGATGAA
AGAGGCGGCGGCCTGTATGACTGCGTGTGTTCATGCTCGACTGTGGCAGGCGCACTTGAAACTGAGCAATGGAGCGAGTGAGAAGTCGCAGTTAATGAGA
TTGCTGGATTGGCAAGATGAAAATGACGATGCTCTCGCCAGTGAAATGATGGGAAAAGCTGAGCTTGCGGCGGAATTTCCAACTCCAAAAAGTTTTCACA
CAGCTCAGTTCGCTCGGTTATTATTGGGTCACACGAATATCTGCGTCTCGCTGCTATCTGCCGTAAAAAAATACGAGGTATGAAAACTTTGACGCCGAAT
TGTTTGGATACCTATGCAACTAAGCTTGACTTAAAAAATATTGCAGGTGGTGCTGCAAGTGGCAGAAACAACTCTGTCTCCGTGGATCTCGCATTTACGA
AGAAGTTCAGAGCAGGATGCAGAGTTGGCGTCATCGTTCAGTGATCGGACTTTTCGAGTACTGTGGAAAATTGCTGCAGCGGTGAATGGTGCCAAACCAA
AGCCTGACACAACAAGTGGTGGACTCCGATTTCGTTTCACAGCCCTGTCATTCCTGCTCAAATGCTCAAACTACAGTTCTTCATACTTTGTGCAACAGGT
GGGAGAATTGCGTGATAAGATAGTTGAGGCGGATCGAGGCGGAGGGCTAACTTTTTCTCTGAATGTTCAATAGGTCCACCGCGTTGGTGTCCAGCACGAA
CGGGCAACTAAAAGATCACAGCAGGGACTCAAGGAACTATACTGGTTTTATGATCAATCAGCGAACGCTTTGAGTGACTCACATCCCTGTTCGACGCACA
TACACCGCGTACGTAAAAATTGTGATAGGGTCCATACTTTAAATTTCAAGGCAACGTAATTAACGGTTTTTTCGTGTGTTGTTTTGAAATGTTGAACAGT
CCGATTCCCTTCAGTGGGAGTATATCCAATGGCTCGAGCACTTCGCTTTAATTTGTGAATTATCTGGGATGCACTTAAGGAGTGCAATGATTCTCGAAAA
TGCGGTCCAGTATGTGCAGCTATTTGGAAGCGCGGGGAAAGCTATTGAAACCTGTCTAGTAGTCTCCACTGCAGGTTCTCTCTTCAGTGCAGCTAGTTCT
GAAAATCGAGGAAGCTGTTTTATCTCACGAGATGGTTTCAGCAGCTCTGCTATTGACAAGAATCTGGAAACCGGCACTGGTAGAATGATACGCGATCTCG
TTCACAACATTTCCTCCGACAAATGGACTGATCAATGTGAAAAGGCTGCGCGAGTGTATCTGAAAAAGCTCGAAGCGTTGGCACCATATAGCTTCGCGTC
AATGAACTCGAAAGATCACCCTGGATTTGTACCGTTCATGACTCGTTCCTTAAAGAGAAGCTCGACGAAAATGTTCAACTATGCTATCGCTGTTCAGCAT
TCTGCAAAATACCAGCTATACTACCAAGTCATAACGAGGTAAGAAGCTTTAGAATTAGTGATTGCATTGTATTTCTAATTAGTCTAACCGTGAATATTGT
AGTTTTGATGAAATATGCAAAGCGGTAAAGGAAGTATGGTCTTCAGTGGCCAACTCGGACGCTAAGTTGATGGAAACGCTCATCCTAGAACAATCACGAC
TCCATCGAATGGACGTTATACTATCGGTGCGGTGTTGTCTTGCAGATAATTCTGCAACCACTAAACCTGCCTTGCGCATGCTATCTCGACATGTGACTTC
AGTTCGTGAGCTTCTGGACAACGCGATTATGGATGGGAAACTGAGTGACTCGATTATCAACGGAGTACTTGGCGATCTGAACTCTATTGCGCGAGAGTGT
TACAGCTGCGCAACTCGTTGCTACAAAGTGGGAAACTACCAGGATACGATCTCAGCTCTACTGGGAGCATTCGAAGTTGTGGAAAGCTACTTGGAGTATG
TAATGTGCAGTAACCTCGATGTAGAAGGTATTCACGAAGCGCATACTCAGCTGAAAGCGGATGCTATCGCCTCATTGCTGGCACATTGCTACCGTGAATT
GGGAAACTGCACAAAATCACGATTATTCACAGGGTACTCTATCTTGTATTGTGGAGACATCCATGAGATAATTCCACGAGCAATTGTCGACAAGTACGTG
TCTTGCATCCTGGAGGAAGCGAAGTTTATGGAGGAGGAGGAACAACCTTCCATCATAAATGAGTTCAAGATTTTCTTGGACAATATCACCCACGTTTTCA
AGTCTCGCCAAATATCTGAGCATCAGATTGTGACACTGTGGAGAGAATTTAGGGATGCCTTCGACCGAGCATCTGCTACAATTGTGGTAAGCTTGCGAGG
CAAGTCTTGCGCCTTGTCAGGTGATGTTGACATGTCATCGGTGGTCCGCGTGCAGATGTGCTGTGAACTTGAACACTACTTAACAGTTAAGTTGGTGAAG
AAAAAAATGAAGGCGATAAACGGTGAATTCCCTATCAGCATTTTGCTGGATGTCTCTCAGTCTTTGGCAGATCGCAAGCTGATTTACTGCTGCTACTACG
CCAAACGCAACATTCGCGACACAATTGAAGGACTTCGACTTGTACATCACTCCTTAGCTGAAGCTACCGAAAACCTTTTGAATTTTTGTGATGCTGTAGG
TGTTGATCTCGGAGGGATTTATGGATGGTGTGGAGTGGTAACGATGGAGATGGCGCTGCTGGTGAGCTATGGTGGCTCCTCAGATGAATACGTTGCATCT
GGAAATATCTCCGTCAGCGAAGAGAGTGCAATTGCAGACATTGAGCGCTGTTTGGCCTACTGGGACGGAGAAGACTCGTGTGGGTTTCTGTTTGATGGAC
TTTACGCTGTGCAATGCTTGGAATCCGTGTACAACACGCTGTCTCTCATTTCGTGCTCTCCACTGGAACAGGCGGCCAGGAAGTTGCTCCAGACATTGCA
CATGTCTGAAAATGCTCAAGGCTTAATGTCGAGTGTGATTCCTCCTCCTATCGGTCTGATGGTTATGGACTCGAGAGAAATGGTCTTGACTGTGGAAGAA
GGTGCTGCAACTGCAGGCGATAACAGAGAAATGCAGCTATTTGAGCAGGTTGACAGAGATCTGTTTGCTGCGAAGACCTCTCATCTGGGTGCCATCAGAG
ACCAAGCGTGCCAACATTTGCTCAGTGCGATGACCACGCTCGGTGATATAAAACAAAACGTGAAGTATTGCCAAACTGCAACCGTAGCAAAGGGAATAGG
CATGCGAGAGTTGTTTGTCCACACGATCCTATCGGACATCCACTTTTATGAAGGACGAAGCAAAGACGCTATCACGGAAGCTAAGTCAGCGTTGCAAGTT
TGTTGGAAGATGGCGAAGAAGTTTACTGCTCCCTCGTCACATACTGAGGCCGCGTGTTTCGAGTTACCACGAGAAATCTCGGCGGCGGAATATTTGCAAC
GGAAATCAGCACATTTTCTGTATTTCATGGCGCTAGAATGCTCTTCATGGGACCTACTGCTAGCCGCGAAGGTGTCACTGTGTCGGATAGCGTCTCTGTA
TAGCCTGGCTGATCAGCCACACAGGTAAGCTCTTTGCATAAATTATTGACGTGCAGTACCGGCTAACCTAATCGTATTGCGTTGTGCTGAAGGGCTGCAT
CTTACTTGACGGAGGCAATGCGTCTCGTAGGTGGTTTGAACCTGCGATTCTTCCGCCGTGGACCTTTTTACGAATACGCGGAGCTGGAGCTGAACGCAAA
CCACTTGGAGAAGGCGAAAGTAGCTATGTCTCTACTGTCATTGAACCCGAAGCCCAATCAGCAATCAAAAACCAATCACTCTATAGCTGATGAACATCGC
TCGACGATCCAATTTGATCCGGCAATCATTGAGCAAAAGTGCGACGAAATCGTTCAACAAGGAGATGTACATCTCAGCGAGGCCAAGCACCAAGAAGCAC
TGGCATGTTATGCAAAAGCCATTGAGATTGTGGATGTTACTGAAGATTGTCAATCTTCCATCTCCAAGAGATTGGGAAGAGTAAAGGCTCGATGCTGGCG
CAAGTATACACGACTGCAAAGCCAAACCAGCGATTTTTCGAACGTATCAGCAGTGAAATCACTCCTCGTGTCGATGAAAAAGCTCAAGCGGTCACTGAAG
TCTTGTGATGTTCATTTGGAGCGAGTCAAGAGCATGCTTGAACTCGGACGCATCAATACAAGGTTGCTGCGGTCGGCCTCACCTCGGGCTTTTACCAGCC
TAGGTCGGACGCTTTCTTTATTGGAAGGAGCCTATTTGCTTGGAGACCATCTGGGTATCCCTCATTTAAACCAAGAATTGCGGACAGCTTTGGGAATGGC
GTATTTTGCAGAGATTGAGGAGAACACGCGCGATGACGCCAGCTCCATGGATGGAGGTGCTCGGGCTGCCTTTCTGTCGTGGGCGAGCTGTGCTCTGCTG
GCAAATGCTGGCAGCGATGATGCGATTTCTATAGCAATGGACAACGATACTTCGACTCAGGACGGTTTAGTGGTGCAGCTTGAGCAGTTGGCTGCTGGCT
CAAACGCATTTCAAAAGCAGGAACCTCAAGAATATCTGACCCGAATGGCCCAGGGCATTGCTGAGAAGGTTCAACACCTGCCAGACAACTGGGTCATTGT
TTCTCTGACGATAGGTTTATCGTCTGAGCTCGTGGTTACGCGCATTCCGGTGCGTATTTTGTATGTTCAATGGTGGCAGCGTGGTATGCTAATTTGGTGT
GATATTGCAGACAAATGGCTCCACTCCTATCTCCTTCTGCTTGCCTACTGTATCCTGGTCAAAGTGCATTCGTGAGATGGATGCCATTATTCAAAATTCC
AGGTATACTATTGGTGACATGAGCTGAAGTTGCCGTGAAATTACTGACATATGTCCATGTGTGCTTTAAAGGCAGGGTTTATCTGGGCACACAGCCGAAG
AAACGAGTTCATGGAACGACGAACAGAAAAGGAAATGGTGGGATAATCGCAAACTGTTGGACAGACGTATCGAGAAGGTCGTCATCTCCATGCAGGTGCG
AACAAGTGGGCGTCCTACGCGTTTCCATCATGATCCAACGGACCTCTAACCTGTTTTATCTTTGCCTTTCTGATGTGTAGAAAAAACTGGGCTTTTGGCG
CTGTTTGCTCGTTGGAGGGTCCACTTTCGAAAGTCAAATAGTCCGTCAATGCTGGGAATTGCTGACCCAGACCAAAACAGGTCCAATCAAACTGGCTGAA
AGGAACCAAACGTTGCTGTGCGCAATTTCGAATGCCCAGCAATATCTGCCAGACAGCGAAGTGATCGATGGACTGAAGCACATTGCAGCAGAGATCGAGG
TGCCGTTATCTGATTCGGTATCTCGAGAAGTTCTTCAAGTGCTACGGACAAATCAAAATGACTTCGTTACTAACTCAACGGAAGCGACCCACTCAAATCT
GACCAATTTGAGCACGGACAAGATCGCCAGAATGAAGGTCGGCGAGGTGAAGCAGCTACTTGCAGCTGAAGGACTCAATATCGATGGATTAAAGAAGGAA
CTGGTGAAGCGTCTTATTGCTGCCCGTGACGCTGCTCTCGTTGACAGGATAAGAACAAGTACGGGGTGCTGTGATGGTGGAAATACCGCTGACGTCTCAA
CCATTTTGATCTTGAATCACCAACTTCAGCAATTTCCATGGGAAGGCATGGACGTGATGGATCTCTGCAGCGGAGTGACTCGCATGCCGTCTCTCGATCT
GATCATGCAGAACGCCAAGCTATTGTCACCGGTACGACGAGACAGAGTGCGCTATTTGCTGAATCCTGCTGGAGATCTTAAGTCGACACAGAATCAACTG
GGACCGATACTGGAAGGAGGAGCGACAACGTATGGCTGGGAGGGGATCGTGGGGGAAATTCCAGACCCCGACAAACTAAGGTGTGTTAGTTGATTCTGGT
GCTATTGACCTTAATTCTGACTATTGTTGCTACCACAGAAACTATTTATTAGCCGCAGATCTGTATATTTATTGCGGCCACGGCTCCGGAGAGGCGTATT
TGCATCGCGACAAGGTCCTCAGTCTGAAGTCCAATTGCAGCGCCGCGTTGCTCTTCGGTTGTAGCAGTGGACGCCTCGAACGGGAGGGAATTTTCGGACC
AAGTGGCGCTGTGCTAGCGTATGTACGCGCTGGCAGCCCCGCAGTGTTGGCGATGCTCTGGGACGTCACGGACCGAGACATTGACCAGCTGAGTGTGAAG
GTGCTACAAGAATGGCTTCTATCAGACAACAAGGACGACAGCCGATCACTGGCGCAGGTGCTGCAGTCCTCGCGAGGCGTCTGCAAGCTCAAGTATCTCA
ATGGCCACGCTGCAGTTTGCTACGGACTCCCGCTGTACGTTGCCAAGAGCTGAGCGAAGGGTTTCGTCCTCTTGACCACTTCAACTTGAGCCATACGAAC
TTATCCCGATTGTAGCAATATCGTATTGTTGCTGCGACCGAACCTGCAGTTCCGCGACATGTTTTACATTAGTAATGATGAGTCAGCCAATCAGAGCGCT
CCACTGACGTGGCGCGTAACCGCCATTCGTGACCAAGCCAGGCGCCGTCAAGTCATCAGACCATTCTTACAAGTGACGAGTGGAAGGAATGGTGCTGCTG
TGCTCAACACCGCCGGCTCCACTGCCTGTGGACGTGGCTGCGACTCGCCCGCTGGTTCAGGAGGTGACTATGTCTGCTGCTGCCCGAAAGCATGTTCGTG
TTTTGGCGGGCAGCACCTATGGACGCTGCGTGCTGGGACTTGGTACGTGGACAAGACATTGGCGGGCTTTGTTAACCTGTATTGACGCGGTTTGGTACTG
CTATCGAAAGCTGGATTCTTGACGATTGCGACAGAACACCTAGCTGCATTTGTCAAGCAAATGTATGGAGATGTAGGCGAAGATGACCTCAAGATTGTGC
ACGAAATTTTGCTCCTGCTTGCTGAGACGGTTGTCGATGAGGATAATGCTACGTTTATCGGTGAGATCTTGAGAGCAAGATGAATTATTATTCTGCACGC
TTAAGTTGCTGATGCTTTCGTTTTGTAGCTCGTATCGGAGCTCACCCATTGCTGATGCGTCTAATGGAGCACGACAACGAAGAGATCCAGGAGGTCCGTA
TTGTTGATATTGCTGCAAAGATCAAAGTCCCAACTTGACGTTGCTTCGATTACTTTAATTAATGGACTATAGGCCGCAGCAGAGGTCGTCACGGCGTGTA
CGAGCAGTCCATCGGCTATCACATTCCCGCACCGTGTGCGTCAGGTTGGAGAAGTGCAGCTCCTGTGGCCTCGTGCAGTGCCGTTGCCTTTCGACCCTCG
TGATAATGTTCCCAAGAATGCTGACGGCACCCAGGGCACTCTTAATGTGCTTATTCGTCAGGTGCCAACGCGTATGACTGGCCAGAGGAAGACTGGATAT
CTTCTATGGGGTGCAGCTTTTGTGCTGGCGCGTTGGATTCACAAACACCGCGATCTGTTCGTGGGCAAGAGTGTGCTCGAAGTGGGCAGTGGCCTTGGAC
TTGGAGGCATTACAGCAGCTCGATACGCACAGAACACCACACTCACGGACTACCAGGCCGACACATGCACGGCGCTCGAGTACAATGTGCAACTTAACAA
ACCGTTCACGCACGAGTACGACCCATCGAAGCCTGATGTCAAGGTTTCGCTGCTGGACTGGGACCTCACCAAAAGTATTGAGGCTGTTCCCAAGGCGGAA
GTTGTGATTGCCAGCGATATTATCTGCGAGCCAAGCACAGCTGAAGGATTTCTGCGCGTTGTGCGCCACCACGTCCTGAGCAACCCCAACAGCGTGGCCT
ACCTCATGAATGCCAACAGCCACAGTCGCTTCGGTGTCGTTCACCTGCACGCGCTGCTGGCTGCGAGCACGGATCTCTCCTACAGTATCACACCAGTAGA
CGAGCTTCCTGACGGCGCTGAGCTTCTTGAGACTGTCAGCGATGCACAAGAGCTGTCGTACGAATTCTACGAGATCCGTGCTGCCTCGAGCTAGAAGAAC
GCGTAGAATTACCAATAGAATAGAGTGCATTTCTGTCTCTTAGACGAGGATATTGTACGCCACAGGCCCAGTGCACCGTGGATCGTCGGGGAAGCCTTCT
CCGTTTGGATTCGAGTTACCAGGTATACCAGTAGCGACACAGGAGCAACGTCCTGAGCCACACAGGTTCGACTTGGCACGTTGCAATTGCTCCTCGCGGG
TCTTGAACTGCTGGCCAGGCTGGGGACAACTAAATGGTGATCTCATCTGTAGTCGCTTCCACACATGACTACGCTGGCACAGAGTCTGCTGAGCTGCAGT
TAAGGTGCACGAGTTGCAAGTACGGCAGACGCGATCCACACCTGCTGCACATGGTGAAACTTCATACTCGTCTAATGTGCATTGAGTACATGGAGCACAC
ACACGATCGGTCATTGGAGAGCAGGCCACCGCTACATATTGACCGGAACGACACTCGGTACATGCTAGTAGACCGTATGAACAACACTGGTTAGTACACG
GGATAAATGCTAGCGGGTCAGAGTACTTACGATAGCAAAGTGTATCTTGTGTAGCTCTGCATGTTTCGAGAGCGAATGAGTTTCTAGGACATACATTGCA
GGTACCACACTTGCGGTCTGTTAGATCCGAGCACGAGCTAGTAAGATACGATCCTGACGGACATGGAGAACAATCTGCAGTCGAAACCTGCAGCATTTTG
CCTGGTGGCCCGACAGCCATGACGGGATTACCAGCAAAGTCCGCCACAAACGAACTCTCAATTCCGAGGAACGTATTCGCTCTTGTGATGCCAAACTGGC
CAGTACCAAAGCTGCTCAGAGCTGTGACGTCGGACCGACCAAGGTGTAGAGTAAGAAACGTGTTATCAGCAGGAAGGCGGTTTGCGTCACGCAACGTGGC
ACCGCTTAACGGATCTGGTTGTGGCGAAAAGAGGCGAGTAGTAGCGGACGAAAGTCTATAGACATCTATTCCTGCCGCTCCCTCAGCAAGCGTCAGCGAT
TCAATTTTCAGAGTTATGAAATTCACCGCCTCCGAAAAGTGCAACTTCAGCAATCGTCGTGGTAAATCTAAGCTGTAACCTACGAGGGTTGGAGCAAGAG
TATCCGCTATAAACGTAGCGACAGCCAGCGCTGCACTTCTTGGCGTCTCCACGGTTACATCTGAGGAGCAGGCGAGAATCCCAGTGCTGTGGCAATTGTC
GACCACGTATCGAAAAAGTCCTGCTTCCGTGCTCAAAAAGACCGAATTCGCGCTTTTTGCCAATCCAATAACACGCTTAAGCGAATTTAAGTCCCCGGCA
CCAATATTTAGCACAATCGTAGATCCGTCAGTACTACTTGAGGTAGTCTGTTGTGGTGTGAATTTAAAAGTTGCGCCATTCTTCAGCACACGCTCGGATT
GAAGCAGTAACTTGGTCACATCCAAAGTCGAAGCTTGAACTGGAATGTTCATCCGAAGTGTCATCGTTCCGAGTGCCATGTCCAAGTCAAACGAAACCAA
GTGAGGCCGCTGAGCAACCCCTTTCAACACCACTTCGAGAACGTTACAATCACCAACTATTGCACCTGTCACACCAGACAATTGCAACCAGAATAAGTGC
GTGTAAGGATCGTAATTCGGCGGATTCAGTATCTTCACGAGCACCTGTTTAGCCTCGGTTTCCCCGTTTCCCCAAGTGACAACGCTATCCAAAAACTCGT
AGTCGACACCTGGCGTTGCAGTACCAGCCACGGCTTTTACGGTCACTCGTACGGGGACAGGAAAGGTTGCAAAATTACGCTGAATTGCCACCGATAGTAC
TCCAGGTTCTGTAACAACTGTACTCGGACATAGCTGGAGCTTAGAACTTGTGTTGCGTGATGCCAGTTCGATGAAGCTAAGGTCAGGAGCTC