Description :
From Genome Similarity Track
Location :
Scaffold_120:10737- 12172
Sequence
1435 bases(100 bases per row)
GTTTAAAGAAATACCATCCGTCCGAGATCCCGGACGCTGATTTGTCCTCGAGTGACGCGGCAACTTTCCAGCGAGATGGTTCTCCTCCTTTGATCGACTC
TTCGGGCGCTCAGCGTTGGATCGTTGAGCGAATCGTCAACCACGACTTTCGCCACCCGTGACGGTCACACTGAAACGTTTCCACAGGGTCGCGCCCTGCG
TGACAAGGAACAACACTATCGCGTGCGTTGGTTGGGACTACGTTCCCGACATCGTGAACGAATACGAGAAGACACTCACGTTCCGAAGCGTGAGTGAGCC
GGGTGCTGATATCCGCGGTGAAGAAGGCGACCAGCCTCCGCGGGTACACGGAGGCGCTCGCCATGATGATTAAGAAGAAAACTGGAGCTGACGCCGGGAT
CGAACCGGTGACCAGTTACACGAGAACTCGGCACTGTACCGCTGAGCCACTCGGTGAGTAAGCCGAGTGAACAAATGAGTGAGTGAGTGAGTGAGTGAGA
GCGAGTGAGTGAGTGAGTGCGGCGCGAGTGACGCGAGGTTCCACGACGACGAGTGAAACCCCAGCTCGCAGGTCACCTATATTCCGACGTCGCAGTCGCC
TGGGTCTACAAGATACTTCTTCGTACGCTGTGCAGTCGCACATCGTCGCTCAGTCAACTGAGCGAAGTGGTTGTCGTCCCCGTATTCGCAGTCTCAAGTA
CCTCGTGCGCTGTCTTCGTGATCCTCGTGTCTGCTAGAACATCGTGGACGTTCCACGATGAGCGTATCCCCAAGTCTCCAGTCGGCGCTCAGTCTTTGCG
TCTGTGGTGATCATCGTATCAGCGTTTCCTTGCAAAAACACTTGCTCGTGCTCTTGTCGCGGAGTTTGGTCTCCGTGGGAATCGAACTCACGCGTACTGC
GCGTGAGCATGCTCCGTTACCCGCTCGGACACGACGTCCCAGAGAATATGATGCGCCTCAGGACAATTCCGGACGTCCAAGCTTCACTCCACCAGAACCT
CACCTGGCGCCTCGAAGCCCACGTGTGTCGACACCAGCGCCAGCGACGGTGGCCTCCAAGCTGTTGTCTGAGATGGCTTCTCGCTCTGCACGCTCGTTGC
CGAGCGTGGTGTCTCTTGTTGATACGCCAGTGGCTTGATGTCGTGAGTGTGGCCGATGTCGCCGCTGTCTCCGCCGTTCCAGCCGTCTTCTCCAATGTTC
TTCATCAGTGCTTATGTTGCGTAGGTGCAACTTTAAGAGGGGGGTAATGTAATGGGCCCCTCCATTACATAAGTAGGTAGATTTCTTTACATAAGTAGGT
GCATCAGCACACGACTAGCGTGTGCGGAAATGCTGTCATGCCATTGGCTGATATATGGGGAGCCAGACCCATTATTAGCCAATTGGACTATGACGTGTAT
TTGAGTGGCCAGGGCTGCGACCTTGGTCCTAAAAT