Description :
From Genome Similarity Track
Location :
Scaffold_301:10734- 12329
Transcript NameFunction/comments
Phyke_g8626hypothetical protein

Sequence
1595 bases(100 bases per row)
GGACGAGTGCCTGCCATTACCTATCGACACAGAAATGACGCGGTGGTGGCGAGATGTGCCCAGCCGCTTGTCGGGTTACGTAGGAAACGGTGTACATCGG
ATGAAGCTTATATGACTGCTCTACGTCGAGAATGCAATGGGAAATTGCTGTTCATTGACTGCCGAAGCCAAACGAGTGCATATGGGAATATTGCACTCGG
CGGTGGATTCGAAGTGTATGTATTTTGTTTTGATCACTGAAAGAACGATAAATATGATTGAATTAACATTGGCGATTCTTGCTATACAGACTGGATTACT
ACAAGGACACCAACATCATGTTCATGGGTATCGAGAACATTCACTCTATGCGAGATTCCATCCGCAAGCTCTTTGACTTGATCAAGAACGAAGTGCGCGG
CAATGAACGCCCCAACTGGCTCTCCTGTCTCGAGGTTTGTGTTTGCGttgttattttttttttttaacgTCACTTGTGAAGATCTAACATTATTGTTTGC
TTAATTCGCAACAGAGCACGCGGTGGCTTGAGCATGTGCGCTCCATCTTAGTATCGTGTTCAGTCTGTGTTgcgaagctggtggaaggCACGAGCTTAAT
GATACACTGCTCCGATGGGTGGGACCGCACTGCCCAAATCGCGGCGTTGGTGAAAGTGTGTGCAGATCCTTTTTACCGCACGGTGAAGGGCTTCCAGGTC
TTGATAGAGCAGGAGTGGTGTGCCTTTGGGCACCAATTCCGTGCGCGGTCTGGTCACACCAATAGCCAGGCAGCTTACTGGGAAGACGACAGCACGTCAC
CTGTGTTCATGCAGTTCGTAGACGCAGTGTGGCAGCTCTTACGCCAGTTTCCGTGCTCTTTTGAGTTCAACGAGCGCTATCTCATCGCGATGCTCGACGA
GGTTTACTGCAAGCGAAGTGGCACCTTCCTTCACGATTGCGAGGAGGCTCGAATGGTTCGTGTTCGTATCTATTGTTGAGTCGTATGGTGAGCGCAGTGC
TGATTCTTGTGTTGGTTTGTTGTGAAACAGGGATCGAAGACAGTAGTTCGATGCACAAGTGCGTGGACATTGCTGCAGGCGCATCCTCAAGCCTCTGATT
TCCTGAACCCGTTCTACATGGTCCCACTTCGAGGCGATGGATCAACAGACAGGTCTCCAacggtgctgcagttcaagtGGCATACGAGCTCGCTGGCAAT
CTGGACGGCATTTTATCTGCGCTCACTGGAATCGAGTGACTCTAGGGTACATCAGGTTCCTTTCTCTTCATTTTATTTGTAGATTTGTTGTATTATTGCC
ACGAGGATAAGCCGTCTCACGTgtgctgtggtgctgcctTGTGTAGGATGCATGGGCCAAGGAGCTTCAAGTCACTCAGCGCGACTTGCAGGCAAAGCTG
AGCACTGCACACCAGCAACTACAATGTCAAGTGGAGCAGAACTCAGATCTGCAAAGCGAGCTGGAGCGACTGCGTCGAGAGAGCGCTCAACTGCACCGGT
TATTGGAAGGCGAAGTGTACAGCGACACATTGAACGGGCTGCTGGTTCAtcaggaagacgaggacgaagacggcgTACTGCTGAGCGTGACCCCA