Description :
From Genome Similarity Track
Location :
Scaffold_114:107326- 109704
Transcript NameFunction/comments
g14420.t1hypothetical protein

Sequence
2378 bases(100 bases per row)
CTTTCAAAGATGCGTTTGGTGTGCTGGGGCTCCCCATGGTCGTCATGGCACTCGTTTGTGTTTCCTGGACCATTTGGTTGATTGTACTCACACTGGCACC
AAACGAGACAGCTAATTATCTCATGGGCACAAGTGAATACGATGACGGACAGTTTTGGCTGATCCCTGAAGAATTAAATGCCCTACAGATTGTCAGCGTA
GCTGGATTGGTGGTAGTTGTGATCTTGTACGTCTTCGTCTTGCTCAAAATGCTGGTTTGGCGCGAATACCATCACGTTGAGGGCTCTTTTCTCGATCGAA
TTTTGAGACGATGTGCGCCTAACAGAATACAATCCAATGACTGGTCCAAGCTCGACTTCCGCCACAGAGTTTACAGATTGATTTGGGAGCTTTATGTGTT
TGTGAAAGAGTTAACCGGGTTTCAGGGAAGACACCGAAAACTATGGGTAAGTGGATGTGTAAACATACAGCAATGTAAGTTGCGGCACTTACACGCACTG
ACTACCGTTTGTGCTCTCTTTATTCTAGAATTTGTGTCTCAAAGCCCTCGACTTGGTGATGCAGTCGCTACTTCTCAGTGAATTATTGGAAGCTGGGACA
CCAGTACCCCTCACGTTTGGGTACGCCGTGTTTGCAGCCTTAAACTCGCTTTTCTGTGCTGTAGAGATCATCAGCCACCGATACACTGCGTTTGCTGAGA
TTCTTATCGATTCGCTGTTCGATTTGTGTGCTGCCGTGCTGTTCCCTATCGTGGTGCTCGTGTATAGCGCGGAAAATTTCGATTTTGATCGTGCTGTGTA
CCAGATCAACGTGGAGGAGCTACCTGTAGGAAGTTTTGAGAGACGCGCACGAATGTTTGCCAGTCCGACGGAAATTGCACTCTTTCGTGTCTCCTTCGAT
TCGCTTAGGATTCGCACCGCGTCGGACTTTTTCCTGCGCATCGGCATGAATATTGGATTTTCATATCGCTTCAAGCGGGTGGTTGAGGTCCTGATTCAGA
TGCAATCTCTACGACAACAGCACCAAGGGAAGAAGAAAGGATCATTGGGGCAACAGTCAATGCTATTGGAATCCCCGAAAGCAGAAAATGGCTCTCGTTC
GTGCCAGCGAGCTGCCCCAAAGTCAGCGGCTATTCTTTTCATTGTGTACAGCATCGGTGTTATTGTCATCACTCAGCAATCCGTATCAGCTTCGCAAAAA
GCGTGCTATTTTCACCCGGAATGCGTTGTGTTCGCCTATCGATGGTACGACACCGAGTTCTGCCCTTGTCGAGCTCTCATCGATGGAAACCGTGCTCCCA
AAACGTACTACGAATGGACCCACCCGGTGGACGCCACAAAAACTGTCAAGGATCTGGCAGCAACAGGGACTTTGGAGATGGTTCAATTGATCAATCGACA
GCTGACGGTGCTACCAGACGAGCTCCGTGATTGCCACAACCTCAATTTCCTGTACGTTATTTGCTGCCCTCCGCGACTGGCACACGTGTCCTCATTTTGT
ATTCGTGTTGTGGTTGTGTAGATCCTTGATCAACTGCGCGATTGAAGAGCTGCCGACTTGGGCAAAGGATTTCCGCAAGCTTCAATATTTGTGGGTAGCT
CATTACCTGGGCGGAATTCGCAACAGGTTCCTTACTGATCAGTTCATTGTTTTGATGCTCAAGACAAATTGAAGGCAAAGTCGGAAGCAAGAACCTCGGA
GCCTTGGCAGACGACCTCTTCAACGATATGCCCGAGCTGCGATACTTGCAGTTTGGACTTCATCAACGAATGACTCGACTCCCACCTTTAGATGGAGTCC
CGAATTTGTCTTGCATAGTTCTTGCTCGCATGGGCGAGTTCACTGCGCTTCCGTCTTTCGAGCATTTACCGCAACTTCAGCGACTCGAGTTCAGCGTGAT
GAAGGACTTGTCTCGGATTCCTGATCTGGCACTTGCTAGAAAAATCGTCCACTTCGCTGTATATCAAGGCGCGTACCTGTGTTGTAATCGATTTCTCGGA
ACCTGCGACCTCACGAACCCGTTTTGCAGCGATGCGACTTGCCTCGACGACCCCGCGCTTATCGCAACTCAGGCAACGCTCAAAGTCTTCGAGGCGTTTT
CTGCAAACGTTTGCCAGCCATATTCCGGACTATCGCAAACTCCAACAGCGGAAACAATTCAAATGTGCGACGGAGTGATGTTTCGACAGTGCCATTTACC
AAGTACCAAGCCAGACACGTGGGTAGTGGGGATATGCTACAGTCATCGCATGCAAGTTATAGCGTGTAACCCGGACCCGGCCAAAATACGAGTTCGGCGC
CGCCAGATTGAGGAGGGCGTGGGAATACCGTGCAACCCAGTGGAGGAATCTTGGCTAGGCTGTAACCGGTCAGCACAA