Description :
From Genome Similarity Track
Location :
Scaffold_65:107300- 108533
Sequence
1233 bases(100 bases per row)
ATGTTCGTAGTATGCACCGGTGCAAGATCAAAAAATGCACCCGGCGATTTGAAGTTATCTGTATGGTTGGATGTTTTTGTTTCGATGACTATCTTTACAC
AACATCAAAGCCCGCGAATCATAAAACAGCTTGAGTACGCTTTGTGATTCGCGGGCTTTGATGTTGTGTTTGCCAAGAAACGTCAGTAACCGCATCTCAG
TGACATCGCAATCTCCAACACAGCGTCACCATACTGCATATACTTGTCATCAATCACAAAGGCATGAGCGAGAAACAGCTTCAAGAACGCAGCCACCAGT
TTGCCGGTGGATCTCGTTTGCTTACTGGAACTATCGGATGAATTTCATATGGGGGGTCACTGGGCATACATGCCTTACTGTACTCGTTGCGTCGTTTGGG
TGGTGGTTCATTGCGTGTATCCTCATTTCTCTCTTGTGTAGTTTTGGCTGTGCCTTGTTGTGGATCTTTTTCTTCCATAATAAAACGCGAGAGTCGAGGT
TATGGTAGGGCTGGATTTATCGTTCAATCAAGGCAGATTGATGAGAAATATTTGGTGCTTCGTGACCGTTCTCGTGCTGTCTTGGGCCTGAATGTAATTT
GTTTGCAGACTTGTGTTCGTGTTTTAGGATAGATGCGATGACCAATCTAGAAGATCGTTAACGGAGTGACCTTGCCGGTGACGTACGCTTCCAAACGTGT
GACAACAAGTCGGTATTTATTGAGCTGCTTCAACGATGAATAATGACGCAGCAGGTTAGTAATAAGTGTTTCAATCACCCTTCCGCTTACGTTGTACGGT
GCAGTCGTGAGCCCTTGATACGCGTTGGATAGCACTGCAGCAACAACTTGTATCTTCGCCTGCGTATCGAAATTGAAGACGTCTAGCGATAGGAGAGATA
CGACGGATGGGTATGTCGCCTACTTAAGACCCGAGCAACCTTGTGATTTTCAGACGTTATATTGAAGACGTACGCGAAGGCCTTGTTCATAATGTTATGT
TCCACTCCCCTCGGTCGGAGTTTCTCTGTACACAAATCTACACCCCATATACATGCTGCGCCCCTCCACGCAAAAAATAAGAAATCAAGCGCCTAGATAC
ACCTGCTTTTGCCACGACCTGATAATGAACACGGTTGACGTAGCTTGTGAACACCAGAAGCGGTGTCTAGGCTGTTCTCATTCTTTGCAGCAGTGGACGA
TGTATCCTGCGAAGACACCACAACCTCTGGGTG