Description :
From Genome Similarity Track
Location :
Scaffold_18:107271- 110378
Transcript NameFunction/comments
Physo_131910hypothetical protein
Physo_131911reverse transcriptase

Sequence
3107 bases(100 bases per row)
GACTCCTATTCCCGGGGATGCTCGGATTGCTGCCACGGCTGCTGGTATCAAGGCGCTTAAAGACTTCAAGAACCCGGACCACCCTTGGCAGCAGCTTCGC
CGGCGTCTCCCGGAGCGCGCATGTTTGTTCTACACCCGTGGATTTGATCCTTCTGTCAAGGTCTCCCAGCGAGCGCCCCCGACGACTCGAGTTAACGGGT
ATTGGAGCAACTTTCGAGGGTACGGGGATCCAGTCGACATTGATCTTGGGTTCTCGGATTGGGAGCGTTACCACTGGATTCCGGCTCCCGCCGTGGAGAA
TTGCTTCCGGATCGCTACCAAGGAGCTGGAAGGGAATAATTGGTCCCCTGAGGCGAAGGCCAAAGTTCGAGCTGAGCTGGACGAGGCCAAGGCTGAGTGG
TTGGCGTATGCTGCCGAGCGGAACAAGCGCTGGAATCGGTTCCGAGCCAAGATCATCTACCAGGTCTGGAGGTGGTTTGTCAGCAAGGAACCGAAGTTTG
CTGCTCTCCACACCGAGTCTTTGTTTGAGCCTTCTATGCTGGGTTGCCCTTTCGACAACCTCACGTGGCTGCCGAAGACGACCGACTGGTTCAGCGAGAT
TTCGGCGTTGGACGCGGCTGAGCCGTGGCGTAATGGCTGGGTGGATGTTCCTGCCCAGCATCCGTACAACACGACGTTCTTCCCCTGCAATCCAAGGTTT
CCGCTGTTCGTCCCTGCAAACACCACGCGCGAGGAAGTCGGGCGCCAGATCGTCGATTGTCCCGACCTCACGCCAAACGAGATCGCGGCTGATTGGGATG
CTGGTTTCCGTGAACCTGCCCAAGCTTCCGACGAGTCTTTGGGTCCTGAGCCAAGCGAGCCTCCGGCGTCTGCAGCTACTTCTCACGTGGCTCTCGACAA
CTCGGACCACCTCCAGGTGCTGGCGCAGGCTGCAGCTTCTGTGAGTTGCAGGGTGACGCTCGCGAGGATGGTGACGACTAGGAACGGTGAGTCGTCGGGT
GCAGGTGTTTCTTTCACCCAAGCTGTTTGAGTTTTCACGGTTGTAGTCGTAGGTGCGTTCAGCTTGGGGTATTTAGGTTTTCTGGATTCTTCTTCCAGAT
CGTCATGTCCAGTTTTCAAAAAAATAAAAATCATGCAAGTCTTCTGCAGTAATCGTCTTCGTCTGCGTTTCTGGGCTGCATTGCCCAAGGTACAGGCCAC
CATCTTCCGCAGTAGTCATTTTGGTCTACCCTCCTGAGCTGCGTTGCCCCAGGCGTAGTTCATCATCTTTGAGGCGTCGCGAGCGAGCTCTAATCTTCGT
CCACGACGTGTACCATTTGAAGGCGTTGCTCGCTTCGCTTGCGCCTCAGGTAGTCGTAGAGAAGACCCCCACAGGAGAGGTGGGTGACTGGTTCCCACGT
GGGCTCGTCCTGATCTGCCCACTTGATCTTGAATTCACGCACTGAGCGTCCCGTTCTTGTTGACATGGGCATCCGATCATCCAGAATCTCCAACACTTCG
CTCTCACCGGCCAGACTATCAGGTTCCCAGCTGTCTTCGGGGAGTAATTCCTCGTCGAAGTCCAGCCGGGAGTCTTCGGTGATGTCAGGCGCCAGTCGAG
TCTTTGGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACATGGACTACCGGGTAAAACCGATAGCCGTTCCGGTTCGGCAACTCGAGCTCGTA
GGCGTACTCTTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGCCGGCCCCGGCTTGACACGTTCCATGTACAGCCAT
ACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGTTGCTATCGACGACTTGTTCCTGC
CAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGGGCTTATTCAGTCGCTTGGTATTCCTTGGCCATCTC
GAGTGCAATCTGGAGTTGTCGGTTGACGTCCCGGTGCCACGCCAGCGCGTCGGATTGTCTGCTACTGCCCCTGCGGAGCGAGGTCGACATCGCTTTCAAC
ATCGACTGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCATGTCTTGTGAGTTGTTGATCGCGAAGACGAACCGTTCCACGATCT
CGCCCCAATCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTCACCGACCTCTCTTGCTGCCCGTTGGCTTGGGGCCGATA
ACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAGGGCCTGGAACACCTCGCTCATAAAGCGAGGATCCCGGTCGTGTCTAACCAACGAAGGT
GCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCGATCACAAATCCCGTGAACGCAC
ATTGGAATAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTCCATGGACACAATCTGGAGTGGTCGCTCTGCCAACACGTT
GCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTGTAGAGGCCGAACCAA
TAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCTTGGTGCCCGCCTTCTAGCGAGTCATGGCAGTTCTGCAACACTTCTTGAATCATTGTGG
TGGGTACCACGAGACGCAGCTTGATCTCCTCTTGCTCTCCAGACGTGTCTCGACGACTCGAATTCACATTGTAGAGTACTCCGTCGTCGGACAGAACGAA
CGTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTTCAGGTTTGCCCACCGTAGTTCCTCG
TCCTGAGCGGCTGCTATGCGCCGTCGCCTCTCCACTTGGACATCGACGGGGTCAATGTCTTCTGCGTTTGGCGCTGCGGGCGGTGCTTGAGCTGCTTTCG
ATGGTCG