Description :
From Genome Similarity Track
Location :
contig_3:1072504- 1073881
Transcript NameFunction/comments
g1001.t1hypothetical protein

Sequence
1377 bases(100 bases per row)
CGGCGGCGAGGCACGCCGTGTAGTCTTCGGGCGTGGACCACCACAGCATGGAGCAGAGGTACCAGGTGAGGCAGACCGAGTCCTCGCACGCGTTTTGCAG
GTACGACTGCGCCTGCGAGTTGTAGTAGTACTGCTCCACCAACGCCGAGTCGGTTGCGGCGCTCACGATGAAGCGGTTCATCTCCGACCACGACAGCGAG
CTCACGTTGTACGCGGTGCTGGCCTTGAAGAGCGGCTGCCAGTCGAGAGCTGTGCTATTGTCTTCGGAGATGTTGGTGCCGTAGACTGTGAAGTCCAGCA
GGTCGTACGTGGTGGCGTCAAAGTCCCAGACCATGAACGCTGGGTTGTTGTAGAAGATCGGCGAGATGGCTGCCGACATGAACAGAGGCACGAGCGCTGA
GCTCTCGGAGCTGGCATCCACTGCAATGACGTCTTCAGGGCTCTGGGACTCCATGTCGGCGGTGAGCGGCAGGCGGAATTCGACGCTATGTGTGTGGCCA
AAGATCTGAGCCTTGACGACATCCGCGTACTCCGTCACGATGTTCTTGTACGCATCGATGTACGAGGCCTCCCACATTGGTGAGCCGTCCTGGGCATCGA
TGATCGGTGGGATGTGGCCGGCGATATACGCGAACTTGTTGCCGTTGCGAAGTCCCGCCAGTGTGGCGTTCAACCAGGCGAACTGAGCAAATGGATCGGT
CTCATTCGATGTGTCTGGGGTATGCTTTGGCTGCACAGCTCAAAAACAGCAGCGTTAGCTGGTTGCGAGTGGCAAAAGACGTACAAGACTGCAGGGGCAC
TCACCGAGTAAGGAACGGTGTTGAGAGTGAGCAACAACAGGTTCTCGTCAAGCTGGTACGACAGGTAGCCGCGGGTGTTGAGGTCCTTGAGATTGGATGC
AGTAAGCGAGTCGTTCCACGCCGGAGACACGACCTCGATCGTCGGGTTCTCCTCAGTGGTCGGGTCGGTGATATTCATCGTGTAGTCTGTGTTAGCAACA
ATGGCACCAGAGTCGGTCAGTTAAAAGTTGGTCAGCAGGTAAGAACAGACAACGTACTCTTCGTGTCGGTGTCGCCCAGGATGGCAGTGGCATTGAGAGT
CTCGTTGCTTGAGCCGGAGAAGTACTGGGCCATCGTCTCCACATTCACCTTGACTGCCTCGGCGAGATACTCGTCTGATGGTGTGTCATGCACGGCATGG
TCACCAGTGTAGAGGAAGAAGTCTGGGTTGGGCAACACCTGCTGAGCGTACTCGAGCGCCGAGACCAGCAGGCTGATAGGAGCATTCGTAGCCGTACTCG
ACTGGAATCTCGGCGGATTCATTTGCGTCCAGGGTCTCGGAGATGTTGAGGTGGACGTCGGAGAAGTGCAGGATGTG