Description :
From Genome Similarity Track
Location :
Scaffold_436:10725- 11727
Transcript NameFunction/comments
g14001.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TTCAATGAAGACCATGGCCGGATTCGAACTGGCCCGCAGAAATCAGCTCTCACTACTCGAAGGCGCCGTGTAATCGGGGGACTACCACATTTCGTTCACC
TCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACA
CCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCAT
TTACAATCAATACAGTTCTCATTTACCATCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTA
AATTACTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTA
ATACGAACGCGGGGCTGAGAACCTGCCCTCGGATAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCAC
CTGTCGGAACCAGAGTGGGAGGCCTTCCAACGACTGTCAACGGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAAC
ACGGTGTTGCTCTGGGTTTCATCGTGAAAGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCATGGAGTCATTGAAACT
CCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTG
TCGAAGGTTGCGTTCGCCATGTCATGTCTGGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGACCCTACGTGCTTTAGCACGTACGAGG
AT