Description :
From Genome Similarity Track
Location :
Scaffold_88:107223- 122500
Transcript NameFunction/comments
Phyin_T30-4PITG_19044Putative uncharacterized protein
Phyin_T30-4PITG_19045Putative uncharacterized protein
Phyin_T30-4PITG_19046Putative uncharacterized protein

Sequence
15277 bases(100 bases per row)
ATTTGGCGTCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTCCTGTGCTTTGAGGATCCGCCC
AATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGACTGGATCCAATCCTACCTCTGGACCTAGTGACTGCCATCACCTGGACGGTCCTTTTC
CCGGATCCAACTACCACCACATCTCCCCGAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCCTCCAATTTCAAAACCACTATTGTATTTT
CGTAAAGCGGCCACTGGCCCAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACT
TTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTG
GATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAAC
TTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCC
ACCTGTACCGTCGGAATCGGGATCTGGATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGC
TCGCGGCCAAGACTCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCTCGAGCTTGTACGGCCAATGTAGTTCCG
GTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATCGTGCAAATTGAAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTT
TCACCTGCTGAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTATTATCCTCAGATCTACCGGATCCATGACGT
AATCATTATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCTCTTGGATCCACTTCACTGTAATTGTACACTCGCCGTGGATCCGAGCTCTCC
AATCATCCAACATCATCTTGCAACCGTCTGTGATCTCCATTGCCCCACGAAAGACCCAGATCCACTGTATCCCTCATCCCTATACCCTGGATCCAGGTCC
TTCTATGCGGGATCTTCCCTCCTTGGATCCCAACTCGGAAGTATGGGATCCGGGGCACCTCGCGGTGGATCCTGACTTCTTGTTAACCGTGGCTACTAGA
TCCACCTTCAGGTGGCACCTACCATTCATTCCTTCATAGGATCCACACTCGATCCCCTCTTATATAGTATATCCCATATCCGTTTAAGTGGATCCAGGTA
AGGGTGGATCCGAGATAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATACTAGATCCATCGTCATTTCATACGGGGTGCTGTTCGCCATGGCTA
ATCCAGCACAGGCAACTTGCATCCGTGCCAGACAACCCGAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCTA
TTCTCTTATTTCTGAGAAAGAACTTCACCACAGTGCCACGACGCATGGTAAACGGTCGAAGTGGAAACCTAGAAGAAGGGCGCACAGATTGCTGCTCGAG
GCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAAAGTTTGTGACGAACACCTCTTCATTCTGA
TTGGTTGGTAAACCGAGCCTAAGTGGGGGAGGATGTAACGGGGTACGTAACCCTAAGTGTACCCTGGTTACATGAAGAGTGACACGTCATACTTCGGGAT
ATTTGGTACAAAGTACCAAGGTCGTCCAAAGCCAACCATTGGTTGATGACATTGCATTTCTATAGGTGACTTATAGTTTGTATTAAACCCAAGCTTTATC
TACCTTTAAATATACTCAGCTTACATTCTACCTAAAATATGTCACTTCACTCCCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAAAGTTT
GTATACTCTCGGAAGCAAACTTCCTCTAACGCAAGGTGCTGTGTGACCCCGTCACATTTTGGGTGGATCTACACTTTTATTATAGCAGTACACAGATTTG
TGCTTTGCAGATGGAATGTCCATCCGTTTTATTGTCTAGATCGAGCTAGGTCCGAGCATAAAACCACGCGTAAAAATGAGAGGCAGGCGTCGATTTGCTT
TATCTGTGATCAAATTACCATTTCAAAACGGCAAAAAGGGTCGATTTACAGGATATCGATGTGGATTTGGTGTCGATTTGACTGTCGTAGCAGCCAGTCT
AGCTAGATCGAGTTGTACTTTTTATAGACCTCGATTTAATAAAACGACCTCTACTTATTAAAAATCGAGCACCAGACAAAGTGAAAGGGCAAAAGCATTG
AAATGCACAATAATTTAAAGTGGTCATAACCCTGACTCTTTTTACATGGTATAATGCGAAATTCATGCTGACGAAAAAGAAAAGAGGACAACGAATGCAA
GGCAAATCAATAGGTGGAGCAGATTGCTCTATTGCTTCTCGGTTTTGTTGCGTGCATACTCAGCGATTAGCTCTGTGATCGCATCGTACGTGTAAAGCGA
TGAAGTGTGGCCATCGCTCCACGTGACCGCGAACGCATAGTTACCCTGACGAAAACAGTTTTGCTCAGTGCGTATTGCTTAGCAAAGATTAAAAAAACCA
CTTTTAAGCATACCTTCCGCTCGACTGCGGTGGGATGGATATCCTCTGGAATCGCGGCTTGGTCCAAGATCTACAGAACAAAACAGGCGTTAAATCGGGA
TATCGAAGGATTAAATCTGATGAACAATACCTGCTCCCCGGTGAATTCATCAATGCATTGAGCGCAGCGGCATCTACTCAAGACAAGCGAGATTTTGTTA
GCTAAATAGTAAGAAATAGCGCAGTGCAAATGCACTTACTGTACTCGAAGGTCCGCTGGGTGAAGCACAGCCTCCTTCGCCTCGTTTAAACTGTACAAAC
GAAGAACAATGCCGCGATTCTTGTCATAGAGTAGCTCGGGCGCCAGGCGAGCTTTGTGCTTCAAAACCACCAGTTCCTTTGCAACCTAGTATCGACTTCA
GTTAAATCAAGTCTACCAACACTTGACACTTTATCAAAACTTACTGTGGTCGCTAGTGAGTCGTACGACTTTTCTTCTTCAGGAAACAACCCTGAGAGAA
CGAAAGGGCTACACCACAGACATATATCATGTTATTCATTCATTTACCAGTATTAATACTACTACCCAACAATGCACGTACCGCCCAGAGTCTGCTGATA
AGCTGAACTGCTCTGAGATTGGCAGCTTGAACACATTTTTCATGTTGTACTTGTCAACAAGCTCTTGTGTATGACCCAGACCTGCACAATTCGATACGAT
AGCCAAATGATTGAATAATCTACAAAACCCATAGCCGGAATTAACTATTACTGACCAAACGGATAGTGGCGTTGCCCATGAGAGCAGTCGAAGTAGGACA
TGTTCTCCACCACAGCAGCCGTTTTCACCTGCATTGGCATCACACCATTGTTAGCGACTCAGTACTGTTCCCGCATTCGAGACCAGCAATTTTACTTGTT
TACACCTTTAAGTCTTCAAACATCGCAATTCCTTTCTCTACGTCGACGAAGCTGAGCAATTAATTACATGTACATCAAGATCAGGTACGGTGAAAAGGTG
CATTGTGACACACATACCTAAGTCTTTGCGGTGTTGTCACGACAACAGCTGCCGAGATCGCCATTTGCTGCGAAAGTGAGATTTGAATGTCTCCCGTTCC
CGGTGGCATGTCCACCACCAGGTAATCGAGGTCGCCCCATTCGGTGCCAAGAATGAGCTGGTCGACCAGTTTCGAGACCATGGGGCCACGCATTACTGCA
GCTCCAACTCCTGCTCAAGCAAGTAATCCGTCGGTTAAAGAGAATCGTTAAGACGTGACTTGACAGCAACCATAACGAGCGTACCCCCAGCACCAGGAGC
AGCACGTTGATTCACGAATCCGAATGACATGCATTTAACACCCTCGTACGTTACAGGGCTCGACAAAATTCTTGACTTTTCTTGACTGACGAATGGTGCG
GTCTTCAGGTGAGACCATCGTGGGCAGACTCGGCCCGTAAATGTCCGCATCCAGAATCCCCACTCGAGCACCACGTTTCGCTAGGCTGCGACCCATAGCA
AAGTGTTAGGAACCCAACATCAATCTCTTCGTTCTACTGCGCATTAATCACCTAAAGGCGAGATTCACCGCCACCGTGGACTTGCCGACTCCGCCCTTAC
AACTGGACACAGCAATGATGTCCGACACATGAGCCAGTGACGAGAGGCGGCCAGCGCGAGCGTTGCGCGGCCGAGACTTGGAGATTTTAAACTCCGTACC
CACGACCCACTCCAGATTTTTCACTGCTGTCTCGGCTTTCTTCTGCCACTAATCACAAGAATTTAACAACAACAAATATTGTGTATCCAAGTAAAGAACG
TGGGGCGGAGGGCCTCCACAACACACTAACCTGCTGTGCCAGCTCCATTAACGCCGGAGTTGGCGTTTCGATCTGGCACGAAACTTTGCCGGTATCAGGC
GCGACGTGTAGATCCTTCAACAGTGAATTTACCAACGAGTTAGAGCCTTGAATTGTGCCACTATTGTGTCAATCCGCCATCACTTCACCTTGACGCGGCC
CAGCGACACAATATCACCCAGCCCCAACCCATCTGAGACACTGCGAAGCTTTTGCAGCACCTGCATCTCCAGTTGCGCCGCCTGACGCGTCGATACATGT
TGCGCGCGAAGAGGTAGACGCGGTGGCACCGAGCGAGCAGCTATCCACCTCAGCATTTTTGACTGGCAAAAAAGGGATCACGGTAATTTATGTTGGTGTG
GTTCACACGATCTGCCAATAAAGAACGACACCCGTCGATGCGATCGTGTGTGTCTGAGCGAACTGAGTTCGAACTGGAAACCAAATCATTGCTGTGTAAA
GGAAGAAGCAGAGGTGGAGGCGTTACTGCACCAGATTGCATTGGCGAAGCAAAAGGAGCTACGACTCCAAGCCGAGAAGAAGCGGATCCGAGGCGAGCTA
AGCCAGCTGGAGGCCGTGAGTTGGAGATACACATTGTCAAAGTGGATAGCATCTTGAAAAGACATTCTGCGTACTTTGATCAATTGTGAGAGCAGGGAAC
GCTATGGTCACGCGAGAAGCAAACGCAGAAACAGTTTGTGGAAGTGAGAAGGGCAAAGGAGCTGCTGGAGGCGCAATAGAAGACGGAAGAGGAGAAGCTC
ATCAGGCTGAATGATTGTCTAAAGGAGAAGGTATGGCTGCCTTTTGCTTGAGAAACTATTAATATATGCTTCGAATATTTGGTGAAAATGTGCATCTGCT
GCTAGGAGCTGAATTTTGACAAGGGTGCCAAATCCAGTCTATTCCAACAGGCCGCAGCGTCTGTGGTGGCAAAATCAGCAACCTCGCCACAACGGCATGA
AAGTCTGAACCAAGAAGAAAACGTGAAGGTGCCAGTGCAGCCGGTAAACAGTCCTAACCCGATACCACTTGTGAATACGATGTCGCAATCTCGCCAAGGT
ACTTACTTCACTGTCAGCATAATTCGAAATTTTGTTTGTGTTATAGAACTGATGATCGTGTTTTGCAGCCATGTCCAGAGTTGACACTCGTGTTTTACAT
GCAGGAGATGATGCGTTGCAGCACCTCGTTCGGAATATCAATTGCGATAAGCAGCAAAAGCGTATTGAAAGACTTCGAGAAGAGCTAGAGAAAGCAAACT
TCCGTCGCGAAGAATTCAATTTCGGCGTACATGTACCGTCTTCGATTATGGTAGATATGCCATCAGATGTCGTTGCGAGTGCTCAAATGAATCAATACCA
CGATACATGCAGACGAGAAATCATTGCACCAGGTATAGCCTTAAGCACTTTTATCAATGGTCATTCTAACTGGCATCTAATCCTCCGTGTTAATAGACTC
CGCAGCAGAGGAAAATAGACACTCAGCAGCTGTGACGAAGGCAGCAATCAAGTGTATTATTCTCAAGCCTCTTGATGGAGCTCACCAATTTTCAGATAAA
GATGCTTCACCAGGTAAAAGCGCCCGCCCAGCCATAAATGCACCAGCAGCACCGCTCACCCAGCCAGCAGTATATCCCACCGCGCCAGGCTCTATTTATA
ATCCGAAGTGTGCTGTTTCGTGTTACCCCCAAATCTATGCTCGGCCAGCCGCCCCAATCAATCCGTACCGATTCTCCTCACCTCCAGTGATGCCTGTGTG
CCCGTACGGAAATGGAGCTCCCTTGTCATATTTACCGGGCAGCCCATATCCAGCTGCACCCCCGTGGCTCCCATCGTACCCTTACCAGATTGGAAGTATT
TCTCCGCTCGAGCAACCATCCAATCCCTTGCTTAGTCAGCTACAGGAAGATATTCGACGATTGGAGCAAGATCTGGAAGTGCAGCGAATCGCCGATGAAC
AACACGCTGAAGCAAAGGAATTTGTAGTAAATCCCGGGCGAAAAACCAATCAACACTCGACAAAGCGGGAGCCACCCCGCTGGAACTTATAGCCAAGTGT
ATTGTATCGGGTAAATCGTAGAATGAGTCTCGAGTCTGATGGTAACCAGATCGAGCTCAATTATCAGCTTCTTTCTAAGGAAGGTTCGCTGGGAAAGTTA
TAAGAAAGATGATATGTAGTTGGCCTAGTTCCTAATATAAAACCCGGGTCGGACCTTACTAGCCCGACTGGGAAGACACGCAGACCCATCGCCTGAAGAT
GGCAAAGCTGCCAGGCGCCCTTGGGTCGTCTCCGTTGAACTATGAGGGAAACCAAGGTGAAATACCTAGGATTCACTACACAGCCCCCGAAGCTTGGTTT
CCCCACTACCCCTCCGCTCGACTTGCGAAGGTTGTGGCGATATCACCCAGAGCGCATGACCAACGGCTAACAAGCGTCTGACGCTTACAACCGGACTGGT
TTCTTGAGGCGCTGACTGTGTGCTCGAGATCTCTGCTGACTGCGGACACGCAGAACTTGGCCCACGGTGGCTGTCATCATTGATCGAGTTCGACGACCTA
GAGGAAGCTGAGGATCTTGGTCCTCGGCACCGGTGTGCTCTTGGCTGTCCTCATCCAAAGTACACTGAACTGTTTGCTGGACACTTCGAGGTTGTACCTC
ATCCGCGTCGTCGCTGTCACGCCGGACGGTTTCTCCATCGGGGTGACTTTGTTTCTTTCTGCCGCGAGGGCGGCCACGAGGCTTCTTGCCCTTCGCTGAT
TCAAGAGGTGTAGACGCCGTGCTGCCGTCCTCACGATCTATCTTCTTCCAGTGATCCGTGAGACGAGGGTCTTCAGCAGTGTCCACATATCTCTTCAATA
AAATCTTGATGTCCTTATTCAAAACTTGCATTGGTTCGTAAGAGTCTTCGATCGACTGTAGGCCCTTCCAGCTTACTAAAATATCAAAGTCCTTTGTAGC
ATTATTCCACTTGTGGCCCTTCAGCTCATTAACTGCTAAGATGATTCCTTGAGCAGCTACGTGTTCGAGTAGCTCATCCGTGACATTTAAGCTGTCGTCT
GCGTACATCTTTAACCGTGAAGGGTGCACATCATGTTCTTCTCCTGTAATCAGGTGCTCTACACGAAAGGAGTGGGAATCGGCCCGAGTCACTCGATACG
GTCCAACCCAATTCACTTGGAGTTTGTTTCCACGTTTCTCATCCGTTCGGGATCGCAAGACGTAATCTCCAACGTGAAAGTTTACGAGATTCTCTCCTCG
TTCGCGCTTCTTGTTCAAAAGTCTTTGCTTCAGTCTTTTGTCTTCAACCACCTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGTGCTGTAATTGGTAATTGGCTTGCACCACCGGAA
CCAAGTAGACCCAGTCTTTGTATCCAATTTTGTATGTTAAATCATTGCTCTCACCACTTGTAGTACATCCCGGTTCACACGTTCAACTGATCCGTTAACC
CACAGACTATACGCAAGTGTGAATGACTGCTTCGACCGGAGACGGCGACTCAGCTCGGCGACAATCTCGTTCTTGAAATGGGTTCCACAATCAGACACCC
ACTCAGGAGGAACACCGAATCGCGAGTGCCAATCCAGTAAAGCTTCAACCACAACACTACTTTCGGCTGAGTCTGCAACAACCAATCCGCAGTAATGTGT
GGCGTGATCCTTCATAACCAAAAGATATTTGCTGCCTCCAAAGCTTTCACCCATGTAAAGAAAGTCAAAATGAAGAACACCATTACGTGTACGACACTCA
ATCACCTCGCTCCACGGACGTGGGATAATCTTTCCCCCTCTTGAATGCAGACAAAGCAGACACTTCTTAACGAAATTTGCGACCACATCTGAGAGGTGCT
CGATAGCGAAAAGCCGTCCCAGGTGTCCAATCATGGCTTGTTGGCCGCGGTGCCCTTGAGCGCCACAGTGCGCAATGATGCACAGCCGCTGAAGTAACTC
TTTTTCTTCATATGGGATCCACAGCTTGTCCTCCAGGGTCACGAGACCATCATCATTTCGATTAGCGTGAACAGGAGCCGAGTTCTTGGCTTGTATTTCC
TTGAGTTCCACCAGTGTAGGCCACACAAAACAATCATCATCCAGAGGGCGCAAAGCAGACACAGTCTCAGTCCTTTGGTTTGGGCGAGCCCGAGCAACCT
TCAGTCGTTTCACAGTTGGCGAATGGTTACCAGCCCAGCGGGAAATTATATCGGTCCATACATTATCAGATCCCGGTACATGCTCCACTACATACTGGTA
GTTCATTAGCTTCATATACCATCGTAAAAGTTTCCCTTTAATATGTTACTTGATCGAAACGTCCGGTGCGAAGATGTGAATCAGGTTACGATGATCACAA
TACATCCGAAAGGGTTTTGGCCTTAGTAGCAAGTAATCCAGTTTATCACAGGCAACGATAATGGGGAATGCCTCTTTCTCGATGACAGATCAGTTTAGCT
GGCTACCGGCAAACGTACCACTTGTGCAGTGAATGAGCCGATGTTGTTGCTCTGTAGCAGGCTTCTGAGGGTCGAAGTCCACAACTTGAGTCACAATAAC
GGCGTATCCAACGTTCGAGGCATCCGTAAAGAGACATGTGGTAGCGTTGTCATCAGGAAAATCGAGAGTAGCAGGTTTGGCGAGCGAATCCTTAATCCGG
TCAAATGCCACTCGTTCATCACTGCTCAGCTCAATGTTAATACCAGCAGCCGCCCTCTTGGTCCTCTTGGTTTTCGTGAGAGCCGCGTCAAGTTTTTGTT
GTAAAGGGGCAATCTGCCTTGCAAAATCAATAATGCTTTGACGCATCCAATTAACCGCACAGACAAATTGCTGAAGCTCTCCGGCAGTACGTGGGTATGG
CGAAGCACGTAGCGAGTCAATTCGGTTTGGGTCATGTCTGATGCCTTCACCACTTATGATCCTGCCGCACCACTAGACCTCAGTCTGGTACAAGCTCGTT
TTCTTTGCACTCAGCTTTAAGCCAAAGTGGTCCATTAGTGACAGCATTTCTTCCAACTTGTCCAAATATACATCAATATCCTTGGCATAAAGGAGTAAGT
CGTCGATCCAAATCAGTAATGGTCGTACAGTAGACTGGCAAAGCAATTCTCCATGGTCTTCTGAAAGAATATCGCAGCATCACTACTACCCTGAGGCACT
CTGCGAGGGGTAAAAACTTTCTCATCGGTCATGTATGAAAGCAATTCTTGACACATTAAAGCCAACGGAAGCTGCCAAAAGCCCTTCAAGAAATCAAAGA
GTCCGAAATGTTTCATTTTCTTCGCGTTCTCCATCACCACGGATACAATCGGCATAACTGCTGCCATGACTTCAGTC