Description :
From Genome Similarity Track
Location :
Scaffold_48:10721- 11864
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_48-fgenesh-gene-0.2Myosin

Sequence
1143 bases(100 bases per row)
GGTGAAAGTGGCAGTGGTAAGACCGAGACGTCCAAGCATGTGATGCAGTACCTGACCACCGTaTCCACACGGAACCGTGCCCGCTCGGCCGCGATCGCCA
ACCGCCGCATGTCTGTCGCCCAGCGCCAGGAGCTCGATAACAAAATCGCGCACGTGACCGACGTTCTCTGGGGTTCCAACCCCGTGCTCGAGGCCTTTGG
TAACGCGCAGACCATCCGTAACAACAACTCGTCGCGATTCGGCAAGTACATCGTGTTGGAACTCAACCGTCTTGGCCAGGTCATTGGTGGTTACATCGAC
AACTACCTCCTCGAGCGCTCGCGTATtATTTACCAGGCCgAGGGCGAGCGTAACTTCCATGCCTTCTACCAGCTGCTTGCCGGTGCGAGCGACGAAGAAC
GTGAGCAGTGGAAGCTGAAGCGCGCCGAAGACTACGACTTCCTCAACAACACGGACTCTCGCATTGAAGGCGTTGATGACGCAGCCAACTTCGAAGTTGT
GCGCCAGAACATGTCGGCCGTCGGTATCACTGAGGAAGAGCAGCGCGAGATTTtCCAGCAGCTCGCTGCACTCCTCTGGATCGGTAACATTCGCTTCCTC
GAGACGACAGACGAGGCGCACAATAAGTGTGTGAAGATCGAGGATCcGGAGAGCCGCGAGGCACTGGAGACGACTGCGAAGCTGCTCGGTCTGCCAGTAG
CCAGCCTCGAGGAGATGATCACGTTCCGTATGCTGAACATCTACGGCGAATGGCAGAAAGTGCAGTTCGACAAGCGCCAGGCGAAAAAGGTCGTGGACTC
GATCGCTCGTTCCCTGTATGACCACATTTTCAACTGGATCGTCGCCCGCATCAACAAGAATGTGACGTGCAACCAGCGGGATGTAGCATCGAGCATCGGC
ATCcTCGACATTTACGGGTTCGAGATCTTCGAAGTGAACGCGTTCGAGCAGCTCTGTATTAACTATGTGAACGAGAAGCTTCAGCAGCTTTTTATCGCTC
AAACgTTGCGTGCTGAGCAGGACGAATACAAGCGTGAAGCTGTCAGCTGGCAGCCGGTCGAGTTCTTGAACAACCAGAGCGTGTGCGATCTGATTGAAGA
CCCTAAGATTCATGGTATCTTCCCACTTCTTGACGAGCAGTGT