Description :
From Genome Similarity Track
Location :
Scaffold_781:1072- 2382
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_781-snap-gene-0.4Autophagy protein 18

Sequence
1310 bases(100 bases per row)
CCGCGTCGACTGCGCATGTGGAACACCAAGACGAACGCCGCAATCTGCGACCTCAACTTCGTTACGGCTGTGCTCGCCGTACGCATGAACCGCCAGCGGC
TCGTCGTTGTGCTGGAGCGCAAGATTTATATTTTCGATATCAACTCGATGAAGATCCTCGAGACGCTCGACACGTCACCGAACCCAAAGGCGCTGTGCGT
GCTGTCGCCGCACGACAATGGCCACTTGGCGTTCCCGTCGGGTGCCGCGCCGGGCGAGATTGTCCTCTACGACGCCAACAACCTCAGCGTGCTCAACGCC
TTCCAGGCGCACCGCACGGCGCCGGTCGCGATGGCGTTCAATTCGCAGGGCACACTTCTCGCGACAGCCTCGGAAGCGGTGTGTACAGTACGCGTGATTT
GAACCTGGAGCACGTGGTGTGATATTAACCAACGGAGAATTGGTGTGCGATGTAGGGGACGCTGATTCGCGTGTTTGGAGTGCCCGGCGGCAAGAAGAAG
GCGTCGTTTCGGAGAGGCTCGCGCGCCGCTCGCATCTACTGCTTGGCGTTTAACGAAGACTCGACGATTCTATGTGCGTCGAGCGACACTGGAACGATCC
ATTTCTTCTCACTGACCGGCTCGGAGACGTCGGCGACGGGGAGCTTTGGGCACTTCACGCCGCTGGCGTCGACACTCTCCATGGCGACGGCGTCGTTGAG
TAATCTGGCAACGACGGGGGGCACTGCTGGTGGAGGGTCCTCTAGCTCGACACCTACGAGCGGGTTGCTGCCGGCAAGTCCCCAACTGTTGCCCAAGCAA
GCCAGCGGCGCACCACCGCCTCGTGCTGCCCGCAGCGCAAGCGGACCAAACTTGGATGACGTGGCGGGCGCTGTGTCTGCATATTTGCCGAGCTCCATGA
AGGGCATCGCCGAAGGCACTCGTGATTTTGCCTACGTAAGAACGCTAGAAATGCTTCGCTCGAGTCTGTACTAACATGCGCCACGATGTGTAGGCTCGTC
TGCGGTCTAGTGGCATCCCCAATCTATGCGCTGTGCATGGGCCAAAAGACTCGAGTAACCCTAGCGTGCAGTTGTACGTCGCGACGACTGACGGCTTTTT
CTATGAGTATTCGCTCAATCTGAACGTTGGTGGCGAGTGCAAGCTCGAGCGTGTACGTGGTTGGCAACGGAGAGGGACTGCATCATTTTGGTTCTATCAC
CGCTCGTTCATTGCGCCACATAGGAAAATGTGCTGCGCGACTCGGCCTCGGAAGAGATCCAAGCCATCTATCTCACATAGCCTTCCAGTGACCTGCTGCA
TAACGTGTGA