Description :
From Genome Similarity Track
Location :
contig_107:107165- 108322
Transcript NameFunction/comments
g13126.t1hypothetical protein

Sequence
1157 bases(100 bases per row)
TAATGGATGTGGTTGCATGTCTTGCACTTCTTGTTCCAGACCTGGTGGGAGTGAGCCACGAAGACCTGGCAGTTGCAGGCGCGGCAAGCTCCCATCATGC
GGGACATCTCGGCCAGCACCTCCTTGCGCTCTTGGATGCCGCGCATGGCACGGTCTAGCGCTTCATAAAGCGGTCTTGCTGCCATGGGCTGACCTACGGA
TCCGCTGAGCAACGCACTCGCCTCGAGGTCTTGCCCGTAGAATTTCCGGTTCAGGTCGTTGCGTGTAGCGATCACAGAGCCCTGAAGCGAGATTCCTGCG
TACAGGCCCTTGCTGATCGAGTAGCTGTAGTTACCATTGAGGCCGGAGCTGCTGATCGCTGCTGCAGCCGCAGCAGATCGCCCATAGGGCCCAAGTGCGA
TGTCCAGTCCCGCGCCCAAATTCACTTGAGGCGAGTGGAAAACCTGCACGGAAGCCGGGGAACCGAGAATGATCATGACCTCGACGATCTCTCCGCCGAT
CTCAAAGCCGCCGCCGAGCCCCACAGTGCCAATAGCTGAGGGCGCAGACCACGAGCCGTCCGGTAGTCGGGACACGACGATACCCGTGCCCACCTTCCCG
ACAACGAGGAAGCCAGCCTTGACGATCGTCATGACCGCCAAGCCGTGTGCGTTCTCGAGCATCGAAATCGGGATGGCCCTGTCCCCGGACGTGCCCGAGT
CGTTCCGGAAGAAGTTGCCAATGATATCCGCTGCGTTCGTGCACTCCTTTTCCAACGAGGGCGAGAACGGCACATGCAGCCTCGACTTGGCCTCGTGTGG
CGCCGTCTCGGCGTTGGCCTTGGCGTATCGAGCCACCAGGTCCTCCTGCAGAGGACGCAACTGAGGCGCGCAGTGCAAACACGCTCGCTGAGGGATGGAC
GGGTCGTAGCCCCTGGCGCCTTCGATCTGGTCTCCGTCCGGGATCAGCAGCAGCAGCGGCGAGCAGGTGCCACACACGAAGCGACCACAAGCACGACTGC
ATCAATAGACAGACCACACAACCGTTAATATCCACCGCAGTGTGGAAGCACTCCTCAGCAGCAGAACGTACCATTGATGACGACGTTTAGTGACGTCGAA
GGCCAAGCCGCAGATATCGCAGTTGGGGTGGTCCGAGTATCGGCCCTTGAGGACACC