Description :
From Genome Similarity Track
Location :
Scaffold_9:107151- 113685
Transcript NameFunction/comments
Physo_129756hypothetical protein
Physo_129757Zinc transporter ZIP (ISS)
Physo_129758ZIP family transporter: zinc ion

Sequence
6534 bases(100 bases per row)
AATTCGGTATTTTACTTCTGCTCATCCTGCTCCAACCATTAGTTGTGGTCAAACATCGCGCTCTACCAGCGTAACTTTGCCGTTAGCCCCCCCTTTCAAA
CAAGCACCACCCAGCACGCGCATCACGACTCGACGTTAGCACCATGACCGACAATCTCCTCGCTGGCCCCGCTCCGAGGCCTACCTTCTCGCCCAGGCAG
ATTGCTGCCTTCTACTTCAAGCCCTGCCTGGACGAGGAGGGAAAGACGACGGGCTACTATGCCTGCAAGACCTCTGCTAAGCGCCGCAAGCACGCGCCCA
AGTCAGGCTACAACAACTTGGTGTCACACGTGCGGGCGGCGCACCCCAACTACGAGAGCGACATGCGCGACGCTAATGTCGCTGCGACGAGGACCCTACT
GCCGTGGGTCACCCAGAAGGCCTCGAACCGCTACGCGTGGCTGCGCTGGATCGTCACGGGCAATCTACCGCTGTGTTTTGCGAGTCCAAGAAAACGCGAC
AGTACGTATTTTCATATCTATTTTGGTGATTTACATGTGTGCTAATGCCGTATGTTATGTAGATACACGAAGCTAAATCCCATCTCCGTGGAGACGCTGA
CCGCCATCATGGAGGCCGTGACCAAGGCCATGGAGACGATGATCGGCGACGCCATGCCCGAGCGTTTTGGTCTGGTCCTTGATGGGTGGACCCACGGCAC
GGAGCACTACATGGCAGTGTATGGCTGCTTTGAGACGGCGACAGGCCCCCAGTACCCGCTGCTGTCGTTAGCGCCTGTCATGGATGAGCCTGACGACCAG
CTGAGCGCTGACGGCCATCTGACGGCGATTAAAAGGTTCCTACCCTTTTTGGTAAGTCTATCTCCGGATGTCTATTCCTGGTTGGTGACAACTGCGGAGT
AAACAAGCGGCTGGCGAACCTACTCGGTGTGCCGCTAATCGGCTGTGCCAGCCACCGCCTGAACTTGGCGGTGCGAAACTACTTGGAGCCCCAAGACAGC
ATCCTCGAAGAGGTCCAGTAGCTTATGCGTAAGTTGCGGACTTTAAAACAAGCAGCCAAGTTGCGGTAAGTACTCTGTTTGCTATTTTATTTGGTTTTTG
TATTGGTACTAAATTGGTCTTTGTTTTTGGGTTTTGTTCGAAATTAGTGCCAAGACCCCATTGGCCGCTGTCCTCAGACAGGACACGCGCTGGTCGTCGA
CCTTTTCAATGCTCAAGCGCTATTTTCGGCTCCGTCCGTTCATTTCGGCGGACGACGAGGAGCTCGCGGACTTCCTTCCGTCACGCTTAGCCCACCCCAA
GCTGGAGACTTTGCTGGCAAGCCTCCGGGACGTCGAGTCCGTGTCCAAGCACCTGCAGGGCGACGGCCTTACGCCCCTGGACGCTCGTGTCCTATTCGAC
GAGCTCCTCAAGAGCCACCCCTCGTTCGCGAAGTATCTCGGTAAGGATCATCGCTCACTCTGCGTCTGATGGTATTTCTACTTAGCTACTGCGTTTTATA
TGTTTTTATTTATGCATAGCCACCGACGCGGATATAGTCCACTCCGCCGTCTTCGAGCAGGCGGTCGTCAAGGTGCTGGACGACCAGGCGGCCCTGCTGA
CGGACGACGAAGTCGCTGCGCTGGAGCCGTTCAAGCGCACGCAGACTCATGTGGAAGGCGTGGACTGCACGCCGGCGGACAAGGAAGGGTTCGCTGTGCG
TGCGCTCAAGCGACGCAAGGTAGCTGCTGCGCCGGCCACGTACGAGCAGCTTAATGCGATTCCTCCTACCTCAAACATGGTTGAGAGGCTCTTCAGCATT
GCGCGCGCTATGCTGCGCCATGAGCGCCACCGCCTTTCCCCCATGATGCTAGAGATGATATTATTCCTCAAGATCAACAGCTCGTACTGGGATGTTGCGA
CCGTGGAGCAGTGCCTGTAAGTAGGTACAGTCGTAACATGCTTGCAGTAATTTACTGTGTCAACACTATGTCTTGCGTTATTTATTCAGTCTGCTACTCA
GATGCAATGCAATATTTATTATGGTGTCCTGCAAACAATAGATATATATCGTATTTTCGGCATGCCTGGCCATGACAGGCGCTGGTTAAGGGTGCCTTCC
TTCTTTGCTTGCGGCCCTTGGAAGGAGAATAAGGCAGCGCTAGACCATAGCGAGTGTACCGTGGTATGGTTACACAACACGTTGAACAAGTATCCTAAGT
GCAACTTATACATCGCTACGGCTTCCTGCTTTTCACATGAACGCGGTCTCCGACAGAATTTTGTACGGCAAAGGTCAGAAAACCAGCCAACTCAATGCAA
GATGGACACGTGCAATGAAAGCTACGTAGGTTTAAAAGTGGAACAGGTTCGCATCGCTGGCAGCTACGTTCGCTCGCCTCGAATGCGGCGTGCTCGGTGA
ATGTCCTTCGGCACAATCTGAAGTCTGGCATCACGCAATGACTGACGTGGAGACAGCGTCCAGGTGCGCTCGCTGCTGGGTCCAGCGGCGCCGTCAAGCG
CGACGAGCAGCGCCGTGGCGCCTGGCTCATTAGGTATCTGGCTCTGGCGAGCAAATCGCGGTATGCCGCTCGGGCGATTAAGTTTTTCGCAGGAGCAGAC
CGCTGGGGGACGCGCGAGTGGTGCCGCCGCTGTCACCACCACCAATGAACTAGCCATCCGCTAACAACAACTGCGAGTGGTACGCTGAGCAATTGCTGCA
GGCTGCACGTGGGATGACACCGCACTGGTGATCCCCACGGCGGTGACGAAGATCGCCACGGCACCGTTAACGCCATTGCCGCCGCCGCTTCCCGTGGATC
ATCTCAGCGAGAGTCGCAGCGAGTCGGAGGAAGCCGGGCGTGCAGCCCAAACGGGGCGGGTGCCTCGGCGCCATTCAGCGAAGGTCTCCGCTGTGATTGG
CTTGGCGCACGCGTCCGCGGCAAGGTCCATTAAGTGTGCGGTGTGCGCAGCCTTGTAGCTGAGCCGGAGCAGCATTTTGGTGTTTGCACGCTCTGTTGTA
GCCGCGAAGCCGCAAGACCGCATGCGCGTTAACTCAAAACGTTCAACAAGATATCGCAGGTCCCTCCTGGACTTCTGAAGAGTCCGCGTTGCCCGCGTGT
TATCACGTTTGGCAGACACCATCGCGAAAGCGGATCGCAGCTTCAACAACATGATGGCAACCCATCCGTGAAGATCTCCGACGCCGACGTAGCAGGTGTG
GCCGCGCTCATGCCTGTCCGCGGGGTGTCCGGATTAATACTCTTTCCAATGCCCTCGAGCCGAGCTGAGCTGAGGGAGGTCTCGAGGCCCCAATGGGTCC
AGCCCAGCGATGCGCCATCCAGTCGCTGCTGCCAGCCTCCCGTCTCACTCTGCAATTCGCAGGCTTCCGAGCACTCGATCACTCCCAGCCATGCTCACCT
GCGCCGCGCTGTCGGCCGCAGTGGCAGTCGCCGCCCTGGCGCCCGCCAACGCGCTCACGAACCTCAAGACCGACTGGGACGCCTATGTCAGCGCGCTGCC
CATTCCGGACGTCATCGACCTGACGGCCGGCGGCTCCATCGACATGCAGATCGGCCGCGCCACGCACAACTGGACGGAGGACGGCTCGCTCTCGGGCGAC
ATCTACGGCTACGCGCTCAAGAACTCGACCCCGACGATGCCCGGCCCGACCATCAAGGTCGCCAGGGGCGTGCCGATCTCCATCACGTGGTACAACGAGC
TGTCCCAGCCGCACCTGTTCCAGAACTCGGTCGAGGACTCGCTCAACAACGTCGAGTCGGCGTGCTACCCGTACTGCGGCGTGCCGGTGGTGACCCACGT
CCACGGGCTCGAGTCCCCGCCCGAGTACGACGGACTGCCGTACCGGTCGATCTACAAGAACCAGTCGCAGGAGTTCCACTACTACAACAACCAGTCCGCG
TCCACCAAGCTCTACCACGACCACTCGAACGGTTTGACCCGCCTCAACACGTGGGCCGGGCTCATGGGCGCCTACATCATTACCGATGACGAACTGGAGG
CGTCCATCAACATGGACATCGAGACGGACATTCCGCTGGTGCTGACTGACCGTCTCATCAACACGACGGGCGAGCTGCTTTACTCGGACGACAACTGCAA
TGCCGGCGCCACCGAGTGGGTGCCCGAGTCCTTCGGCAACGTGAACCTGGTGAACGGCGTGATCATGCCGTACGTCGAGGTGCCGCCCGCCCAGGTCCGC
TTCCGCCTGATCAACGTGGCCAACGCGCGCCACTACAACATCACCGTTCCGTTCGAGGACAAGTGCCAGATCGTGGCCACCGACTCCGGATTCGTGCACA
AGCCCGAGTCCTTCAGCGACTACCTCGTGCTCTTCCCGTTCGAGCGCATCGAGTTCGTCTGCGACTTCACCAACGACACGAATGGCACAACCTACAAGCT
TATCGACAACGAGACGGCGGACCAGCCGACGGCTTATGATGAGCGCATCATGCAGATCCGCGTGGTGTCGAGCCTCAAGACGGACACGATGGAGTACCGT
GAGATCCCATCGACGCTTGTGACGTACAAGTCGCTCAAGGAGCTGTACGAGGCCGGCGGAAAGGAGCGCACAGTCATCCTCGGAGAAATGGACACGGCGC
TGCAGTGCCCCCTGTACGACATGATCATGTACCGATCGCAGCAGATCAACATGACGAGCATCACGGGCAGTCTGCACTGCACCAAGGGCACGGTGGAGAA
GTGGAACTTCCAGAACCCCACGGACGACCCGCACCCGTTCCACTGGCACTTGGTGAACGCCCAGTGCGGTGACACGGAAGAAACTATCGACACGAACCAC
CTGAAGGACGTCGCCAAGATCCCGAATGCCGGTGACCGCGCCACGGACACCATCACCCAGGTCTGCTACGTGGCCTGCACCCCCGACGAGTACCTCATTG
CGAACAGCACCCGTGGCGCCAAGGACTACGGATTCGACACGACGGAGCCGTACGTGGCCCACTGCCACATCCTGGAGCACGAGGAGAACTCGATGATGAG
CTGGTTCAAGATCATGGACGTGGACGACGGATACGCCGACGACAACGGCATCACTCCTGGCACGGAGATCACCAACACGGTTATCGCCACTGCCATGGGC
ATGAGTGTGCTGGGTGGCATTGCCACGACGCTGTCGGTGCTGGTGATCTCGGTGGAGCGTCTGAAGTTCCTTGCCGACCCGCGCTCGCTCTCCATCGCCT
TCGCGTTGTCCGCTGGTGTCATGATCTTCATCGCCTTCGCGGATCTGTACGCCGAGGCCCTGACCTACTACCGTGCTGCGTTCACCCCTGGCACGACGGA
CCCCGAGGCTTACGAGCACGGAGGAAGCACCACGTCTACCGGTGTTTGTGACGACACGTGCAACGGTAACACGTACCTGGCGGCCACGGGCGTCTTCTTC
GTCGGCATCGCGATCATCCTGTTGGTGGAGTGGCTGGTCCACTCCGTCTTCGAGCGCAAGGACCGAGCTGCTGCTGCTGAGGCTGCGGCCAAGGCGGATC
AGGAGGACGGTGACAAGGCTCGCTTGGCGGAGGAGGGTGGTGACAAGGCCAACATTGTGCACATTGCGTCTCCCGTGCCCGGCACCCCTCTGCCAAACGA
TGGAGCCCACGAGCTCGCCAGTCCTGCTGGAGAAGAGTCGGCGGCTCTTATCGAGGAGAGGAAGGTGAAGGAAGAGTACCGTCGTGCGGGTGTGCTGACG
GGTATTGCTATCGCCATTCACAACTTCCCCGAAGGCCTGGCGCTGTTCGTGTCGTCGCTTGCCGGTCTCCGCACGGGTATCGTGCTGTCCGTGGGTATCA
TTCTCCACAACTTCCCGGAAGGTGTGGCTGTGGCCGCGCCCGTGTACTACGCTACTGGAAGCAAGGTGGAGGCCTTCAAGTGGACGATCATCAGTGGTTT
CGCGCAGGTGCTCGGCGCTGGCATCGGCTGGGCTGCTGTTTCGGGCGGCATGAGCTACGCTCTGGAGGCCACGCTGTACGCTCTGGTGGCTGGTATGCTG
GTGTGTATCACCGCGAAGGAACTGCTGCCGGGCGCCTACAAGTTCGACCCGAGCGGAAAGCTGTTCGTGCCGTCCTTCTTCATCGGTATCGCCATTATCG
CGCTGAGTTTGGTCGCGCTCAACTACGCTGGATCAAGCTAAGTGTAGAAGAACCCAATCTTTTTAAACGTAACGAGATGAATGCAAAGTCTGTGTCAATT
GATTTCTAATGCCGTTAGCGAGTTGATGGTAGGCACCGGTAGATTAGCCGGAGCCGGCGTACTTGAGAGCCATGACGCTGAAGGCGATCACCGCCATACC
GACGAAGAATGCGATCACGAATACTTTCCCCTTGGGGTCGAACTTGTAGGCGCCCTTGATCAGTTCCTTCACCGTAATGCAGACCAGCATCCCAGCCACC
ACGCCGTAAAGTGACGCCTGGAGACCAAAGCTCATTCCCCCTGAAATGGCAGCCCAACCGATCGCTGCCCCCATCGGCTGCGCGATTCCGCTCAGAGCCG
TCCACTTGAACGCCTCTAGCTTGCTTCCAGTGGC