Description :
From Genome Similarity Track
Location :
scaffold_15:107150- 108380
Transcript NameFunction/comments
Plaha_PHALS_00692hypothetical protein
Plaha_PHALS_00693hypothetical protein

Sequence
1230 bases(100 bases per row)
GTTTGCCGCTACATCGTGATATGGCTTTAGAAAATTATAGTAGGAATTTTCTGCTCGTACGTGGCGCGCTATTTCTAGCAGTGTTTTGAATAATGTATCC
TTACATTACCAATCAGAATAATGTGCCCATATATTACAAATGTAGTGGTCTTCTCCTACGGTAGCAATAGTGTATATTTGGTGACTGGCAATTTATTGCA
AACATTACTTACAGATTATTCCTTAAGATCAACCAGGGCTTGTGCCGGATGTGGTGAGTAAAAGGATTAGATCTCTTGACTACTTTACATACCTTCATTA
ACAGTGAGCAATCGTTTCTGCCACAAAATCTACAGCATCACTACCTCGCATAATGGAAGGTTACAGGGTACTTCTGAATCAGCAGTACTGATACATCGCG
AAAAGGATAGGTTATAACGCCTTGTTTTCCTAATTGCGTTAAATAGTCGCCCATCCATTCAAAAGACCGCGATTCACATTGGCTTCTCGTCCAGACAGGC
TCTGGCGCAAGAGACATCAACTTGTTGCTGTTTCCACCAGATACACGACAATACACCGTCTTTTATTTACTCTCGGTAGAGAACACCTTTTTGCTCACAA
AATATGACTGCTTCTCTCTAATTCATCTTGTGGCCGCAGCTAATTCTTACTATTGAGCCTTGCTCCAGGCTACGGGGAATCTCGTGATCCGCGCCAAAGC
TATTGTAGTTCCGCGTCATGGCCGAAGCGCTCTGCTTCCTGATGTAAGTCAATTCATTCCTCATCAATCCTTCGCCTGGAAAAAAGTTGTTCGAGCTACT
TAACGTTTTTAACTTGCCTTCAATATATGGATCATTGTTTGTAAGTCACGCCATACTTAGGATGAGACGCACCTCAAATCCATACCTAAGACAAGAAAAA
CTTCGATGCTGTAATAGTCCTCAAGTCTAACAGGAAAGATCAGCAGAACTTTCGACCGTTTCACCAGTGTTCCCTTCGCAAGCCATACGAACTCTGTTTC
CGAAATTCAGATCCTTAATGCTTCCAACTACTGCACACGGTTGTTTTACAGTCGCCCATATTACGTTAGTGTATCAAGATTCGGAATTTCTTAAAATTCA
GACATTACGGTTTTCAACCAACAGTTCTGGGCTGTGAGTCCCCCTTCCAAAAAAATTTGCCGCTTTTGAGAATACATTCTAGATTGACCtataaaaatat
ataaaaaatctcATTAGATTCCTAGTAGGC