Description :
From Genome Similarity Track
Location :
Scaffold_16:107072- 121108
Transcript NameFunction/comments
Sapdi_VS20SDRG_05889hypothetical protein
Sapdi_VS20SDRG_05890hypothetical protein
Sapdi_VS20SDRG_05891hypothetical protein
Sapdi_VS20SDRG_05892hypothetical protein
Sapdi_VS20SDRG_05893hypothetical protein
Sapdi_VS20SDRG_05894hypothetical protein
Sapdi_VS20SDRG_05895enhancer-yellow 2 transcription factor
Sapdi_VS20SDRG_05896hypothetical protein

Sequence
14036 bases(100 bases per row)
GCGCTTCCGGGCTCTCCAACAAGTGGAGCAGCTCGCCGTTGTCCATCTCCAAGAGCATGCCCGTGATCTTACCGGCAAGCTGCGGCTGCGACTTCTCGAT
CAACGGGAAGAGGCGCTCGCCAATCATGTTCTTCTGCATGTTGGGCGAGGCAGCAGCCAAGGCGGCCGACGTGAGCGGCTCCATGACCGGGACGGCCGGC
GCCGCCGGGGCGACTTCGGGTTGGTTGCGCGCGTTCGCAGTGTACTTGAAGTTGTTGCGGTTGTTGCGCGGCTGGCCCTGCATCTGCGGCGGCACCTGGC
CCTGCGGGCGACGACCACGCGGCTGGCGCGGCTGGCCCTGCATGGGCATGCCGTACTGGGGCATACCGTAGCCGGCCGGGCCGGGGGCACCGGGCTGGCG
GTACGGCATCGGGCCGCGGGGCATGCCACCACGCGGCATCATCTGCTGCGGGTAGACAAAGCCCTGGCGCGACTGCGGCGGCATCTGGTTGGGCTGCGCG
TAGAACATGGGCGCGGCGCCGTACATGGGCGGCTGCTGCATGGGCATGCCACGGCCGACGACCATGCCGGACGCGCGCTGCTGGGCGTGCTGCGCTTCCA
ACTGGGCGCGGCGCACTTCCTTGCGCTGGGCGAGGGCCACGTAGATGGGCTTGCCCGAGACGAGCTTGCCGTTCATGTCCGTGACGGCCTTGGTGGCCTC
CTCGGGCGTGGCAAAGCACACAAAGCCGAAGCCGCGCGAGTTGCCCGACGGGTCCTTCATGATGCGGCAGCTCGTGATCGTGCCGCAGGTCGTGAACGCC
TCGCGGAGCTCGTCGTCGTTGAGCTGGTCGTCCAAGTTCTTGACGTACAGGTTGACGCCCTGGTACTTGTTGATGCGTTCCATCTTGAGCGCCTCGAACT
TGTTGCGGAGCTCACGCTCGCGCTCGCTGCGCTTCTGGGCCTTGCCAACGTAGAGCGCAATGTCGGCGCCGTCCTCCTGGCCGACCACCTTGTCGTTGAG
GGCCTCGACGGCCTTCTGGGCCGACTCGGGCTCGTCGAAGTTGACAAAGCCAAAGCCGCGGTTGCCCTCGGACGACGCGTCCTTCATGACGACGCAGCTC
GTGATGGCGCCAAAGACCTCAAATTCCTTGCGCAACGTCGCGTCGTCCCAGTTGTGCGGGATGTTCTTGACGTAGCAGTTGGTCCAGTCGGCGAGGTCGG
GGCGGTCCTGGCGCTTCTGGAAGTGGCCGACAAAGACCTCCGAGCCGGCGATGAGCATGCCGTTGATCTTGGCAATGGCCTCGTTGGCGGCCTCGGCCGT
CTCGTAGTGCACGTAGCCATAGCCCTTGGAGCCGCCCGACGTGTTGTCGATCGCGACCTTGCACGAGAGGATGTTGCCAAAGAGCGAGAACGTGTCGTAG
AGCGCCTTGTTGTCGATCGAGACATCGAGGTTCTTGACAAAGATGTTGCCGACGCCCGACTTGCGGAGCGACGGGTCGCGCTGCGACCACATGATGCGGC
ACGGCACGCCCTTGATGCTCGTGTAGTTCATCGTGTCAAGCGCACGCTCGGCGTCCGAGACGTTGTGGAAGTTGACGTACGCGTAGCCCAACGAGCGGCG
CGTGACGGCGTCGCGGCACACCCGGATCGACGCGACAGGCCCGACGGCGTTGAAGATCTCAAAGAGCAACGCCTATGGTATCATAATGCCACCATGAGCT
GCGGTCCCTGTGCACACGCGATATATGCAACGTTTCGTCGTGCCTCGATTGAATGGTGAGGTTACCTCTGTCACGTCGGGGTGGATGTCGCCCACGTAGA
GCGACGCCGTGTGGAACGGCTGCGCCGGCGCGGCAGGCGAGGCCACAGGGGCGGCGTTCGTCGCGGCGACGGGGCTCGAGGGGGCAGCGGAGGCCATGGT
TTTTTTTCTACTTTTTGTTGGTTCGGAAGGAAGGAGCTTGATTCGAGATCTTCGTTGCCGCCGGGGAAGGACGACAGGAAGAAAGCAAACCAAAAAACGG
GAATGGCTATCGCCAAGGCTATTGCTGCACTTCTCCACCAGTCAAATCGTGCCAACGGATTCCCCACCAACCTAAAGTGCACCAATCACGACCGCTTCTA
CTTTTCTTTTCGACCAATAAGACGCCCGCATGGGCCCCGTCCCTTGAATCTTCTCTCAGAATGCATACCTTCGGATCTTACATACGGGTTTTTTCCCGCG
CCCATGGTGGCTTTCCCTCTGATACTCGATACATTGGAACACTTGATGCGCATCGCATCTGATTTGCCCGGTTCAAGCGACCCAACACACACTATTAGCG
TTGATTCGGTGTCGCCTCCGGTATAGTGTATAATAGACCTTGCGCACCACGACGCTGGACGTTCGAGAAGCGACCATCTCCCAGCGCAATCTACCACTCA
AAGCTATACAAGAGGCTACTTCATTGCTCCGCACGGCAACACTACTACTAGACCATCTGCAGCTTCGCTACCTGCCGTCAATATACTTGCCCATCAAGCC
TACTGGTAGTAGGTACTGACCGGAGCCTTAGCACAGGCAGAGACTATAGTCGTACATTACCTTCCGCTAGCTAAACACCCGAGGGGAGCACACGGAGTCT
ATCGACGATGCCAATCATCGCGCGATCTTTTGTTGGGACGAGTCGCGGATCGTTTTTCTCGGCATATGCCACCGTGTGTGCCACATTCGCGTGACACGAC
CAGATCCTGCCGAATTTAGCGCACGGAAATAGTGTGTGGCGTCACTTGCCATGTCGATCCGATACGCGTGCGTGTGCGGCCGGCGCTACCCGCTGGCAGA
GCTCTACTGGAGCGACTCGTGCAACAAGCTCGTGTGCCCATGGCCGACGTGCTCGCTCCAGGAGATCGACTCGTACTTTTGCCGCTTCCAGATGGACAAC
CTCCCGTCCAAGGAGGCGGCGGCCTATAAGAACCGGTCGGCGCGCACGTTTGCGTGCCCCGACTGCGCGACCACATTGCAGACGATCAAGACAGGCGACA
AGTACATCTTCTTCTGCGCCCACTGCCGCTGGGACTCGGAGGCGATTTTGGCCGAAGATGACCCCGACACGCTCATGATGGTCGCCAACACGCGCGAGCG
CGACGACCACATCTTTGATACGCTTCTATCGCACTACCAACAAGCGTCGGCGCAGCACGCAGCGGCGCACCCGACGAAGCCTCTCGCGTTTGGCTCCCTC
GCACGGTAAGCTTTCTGCTACGTCGTCTTTGGGATGGAAGTGGCATGGACACACGTAGGTTTGGCAAGCCCCATTTTCAGGTCAAGGCGCCATCGACCTT
GGGCTGGAAGATGGAGCAGCTCGACGAAAAGCTGCACAAGCGCAGCATCGACAACGTGCTGTCGCCGACCGACCAAAAGCTGGCCGCCGCGCTGCGGGCC
AAGTTCCCGAACCACAAGAGCTTCGACTGCGCCGACGATAGCGACGCCGTCGCCGCGCTCGCGTCGAAGAAGTACATGTCGACGATCTCGACGTTGCACC
AGCGCTATCGCTGCAACCCGCTTTTGCAGAGTCGGGACGTGCCCGCGCTGTACCCGTCGCGGCCAGACCTCCGCGTGAAGCGGTCGTGGCGCTGTGTCGA
AGCCATGGCCAAGAACAACCCTGGCATCCTCGTCAAGCCGCAGATCAATCCGATGACAGGCGACAGCTCCATGGTCGTGTCGGCGTCGTGGTGGAAGAAG
GCGACGCTCGGCATCCACTTTGTGCCCAACGTGACGATCCAGACGCTTTGGGCGAACGACCACTGCTGGCTCCTCCTTGAAAACCCCCTCGAGGACGACA
TTCTCCTCACGGTTGCCGCCAAAGCTCTCGAGAGCGACGAGGGTCCCCCTTTCATCGTACGTTGCTGCTGTCGCTGCATATCGTGATGCATGCTCGTGGT
CTTGTAGCCCGTCGTGCCCGCCGGTCCGCTTGCGATCGGCGCATACGAAGATCCCAACTTGATGGACACGTCGCCAGCCGAAGTCGCCAAGTTTGACGGT
GCGTACCTCGAGGCGCGTGATCGTGTCTTAGACGACTGTGCGAGCAGATGTGACGTCGGACCCGACAAAGACGGTGCTCACGTCGCGCAACTACGCCAAG
TTCAAAGTGCACGTACGTGGCGCCACCACGGCGCAGGAAATGATTATGATACTAGAGCGAGAACGCGATGGATCCCGTTGCGTTCCAGCTCGAGTTTCAC
ATGTACAAGGTCGAAGACGAGGAGCACATTGGCGCGGTCACGACTGTCGAAGGCCGCCCGCTGCTCGCCATCTTCACGATCGATTTGGAGGTCCCCATGG
CGGCTCGCGTCTAACCATGCGCGCTACGAGTCGAGAAATGAAGTTCATATTGCATGCTCGACCACTCGTAGCATGCACCGATTGCATGCAAGCATGTGCG
ATGCTGGACGCTCGCCTGCAGGTCTCGCAATCGTTCGCATCATCCTTTCTTGGCCACGCCCTCGACGGTAGCACCCCATGCACTCACGCTGCGCGAGCCG
CTGCACGCAGGTCGTACCTTGCGGCGGCGCGCGTACAGAAGGTCCATCTTGGAGACACTGTTCGGCGGGCGCATGGTCATCGCCCACCGCCCGCTCGTCG
CGGCCCCAAACGCGCTCGTCTACGGATGTTTGGATCGTATCCGTACAATCCCCAAGTTTCGCGCGAAAACGCGATAATGAAAACGCCTCCAAAATACAAT
GTTGTTTTCCCTTCACCTAAGTTTTCGCTACGAAAACCAAGTTGTTTGCCGCCTCACCACTCGCAAGGTGCATTAAAACAGCGTCGAATACTATCACTTG
ACAAAACGCGGGATCCATGGCAGGTCGCGGCCAAGGGACCGGCGGCGGCGGCGCCGTGCCGCAGGCGCCGCGCATTGAGCTCGTGGTCGACGAGACGGCC
GAGGTCGTCAAGATGCGCTTCCTCAACCACCTGCGGAGCGAGGTCTCGTACGAGCAGCAGAAGGAGCTCATGCGCCAGTCCGAGACCTCGTCGCTGTTTG
TCGACTACTCGCGGCTCTTTGCCGCCGACGCCGACTTGGCGCAGGCGATCGCGACCGCGTACTTGCGCTGGGAGATCCCGCTGCGGCAGGCGGCGGCCGA
GTTTTGCGACACGGGCCGCGAGACCTTTGTGTGCTTTTACAACTTTACGACGGTGCGCAAGATCCGCCAATTGAAGATGACCGAGGTCGGCAAAATGAAC
AGCTTCTCGGGCACGGCGACGCGCACGAGCGAGGTGCGACCGGAGCTGCTCTTTGGCGCCTTTACGTGCGTCGACTGCGGCGGCGTCGTCGAAGGTGTCG
AGCAGCAGTTCCGCTACATGGAACCCGTCAAGTGCGCCAACCCGTTCTGTGGTAATACGAGCCAATGGGAGGTATGTGGCGACTCTCTACACTGCAAGAA
GGCACGTGCTCAACGGCGACGCTAGCTGCACCCCGAAAAGAGCGTCTTTGTCGACTGGCAAAAGGTCAAGGTGCAGGAAAACAGCGACGAAATCCCTGCA
GGGAGCATGCCCCGGTCCATTGACGTCATTCTCCGGCACGAAAACGTCGAGCAGGCAAAAGCAGGCGACCGCGTCGTCTTTACGGGCGCGCTCATCGTCG
TCCCCGACACATCGCGCTTTGGGAAGAACGGCGGCGAGAACGTCGTGACGCGACGAGGAGGTATCTCACGCGTCTTCTCAAACCAACCACGATGCAATGG
CGTCATGCAGGTGAAAACAGCTCGTACGGCATGGAAGGCGAAGGCGTCCGCGGTCTCAAGTCGATGGGTGTCAAAGAGTTGACGTACAAGACGGCGTTCT
TGGCGTGCTCCGTGCAGGTCCAATTCGCAATCTCATCCACCTCTCAGATCTGATATGATCATGTTTAGACCATGGCCCAGCGCTTTGACCGCGTCTCGAT
CCGCAGTGAAATGGGCGAAGAGACCGAGAACGACTTTACCGAAGAAGAGCTCGAGTCGATCCGGCTCATGAAGGCCGAGGCCGACCGGTACACCAAGATG
GCCAAGTCGCTCTGCCCGAGCGTCTACGGCCACGACGAGATCCGAAAGGGTATCCTCTTGATGCTCTTTGGGGGCGTGCACAAGACGACGGCCGAGGGCA
TCAAGCTGCGTGGCGACATCAACATTTGCATTGTCGTACGCATTCCGTATCGTTCGGCCCCCTTGATACATTGATACTAGGGCGACCCGTCGACGGCCAA
GAGTCAGTTTCTCAAGTACATTGTCAACTTTTTGCCGCGTGCAATCTACACGAGCGGCAAAGTGAGCTCGGCCGCGGGTCTCACGGCGTCCGTGTCGCGG
GACCCGGACACGGGCGAGTTTTGCGTCGAGGCCGGCGCGCTCATGCTCGCCGACAATGGCATCTGCTGCATCGACGAGTTTGACAAGATGGACCCGATGG
ACCAAGTCGCGATCCACGAGGCCATGGAGCAACAGACCATTTCGATCACAAAAGCCGGGATCCAAGCCACACTCAACGCGCGCACGTCGATCCTGGCGGC
CGCCAACCCTCAGAACGGTCGGTACGACAAGACCAAGGTATCGCACGGATACCGAGTCGGACGGCAGCTTCATGCACACGTAGACGCTCAAGTACAACGT
GAATATTTCGCCGCCGATCATGTCGCGCTTTGACCTTTTCTTTGTCGTACGACGAAGATGCGTTGCCCATCTTCTCATGTCTGCGACATGCATCGTAGAT
CTTGGACGAGTGCAACGAGCAGGCTGACGAGCGCATCGCACAGCACATCGTCAACCTCCACAAGCCGCGGGCGCTCCAGTCCGACGCCGACCACGTCGAA
GCGTACCCGGAAGAAGCGCTGCAGCGCTATATCAAGTTTGCGCGCACGCTGAGCCCTGTCATTACCGAAGATGCCAAGCGCATGATGGTCGCGTGCTATC
GCCGGTTGCGTGAGAACGACGTGACGAGCAACGGACAGAGCAACATTGCGTACCGCATTACCGTCCGGCAACTCGAGTCGATGATTCGCCTCTCGGAGGC
GCTCGCAAGGTTAGACCTCGAGGAGACGGTCCAGGTCGAGCACGTCCAGGAGGCGTACCGGCTCCTCAACAAGTCGATCATTCACGTCGACACGGAGAGC
ATCGAGCTCGATATGCCGACGCTGCCACCTACGGACGCGGTCGAGGCCGAAGCGCCAACACTGCCAATCGACACTACGAGCGACGCGACGGCAACGCCCC
AAAAGGCAAAGAAGACGAAGAAGAAGACGGCCAAGGACGTCGAGACGGACGCGGGCTCGATCTCGTTCGAACGGTTCGCGGTCGTGCAGAAGGCGCTGGC
GCTCTTTATTCGCGAGAAGGAGGAGGAGATGGAAGCGTACAAAGCGATGTCGCAGGCCGAGCGCGCGGCCGACCCGAGTCTCCGCACCGAAGAGGACGAC
GCGCTCGACGCGTGGGAATGCGGTGTGCTCCAAGCCGAAGTCGTCACGTGGTACCTCTCGTCCCAAGACATTACGTCCGAGGTCCAGCTTGGCCACGAGC
GCAAGATCATCAACTCGGTCATTGAGAAGCTCATCAAAGACGGCTTCCTCCAAGTCGTTGAAGATGGCGGCGACGACGAGACCGATGCGATCCAGAACCG
GTACCTCACAGTGCACCCCAACTACGCTCTCGACTAAACCACTACCCAATGTGTCTTCACAAATATACGTGGCAGCAGCAGGAAAGAGTCAGGCGCCAGA
ACTGCCGCTCCTGCTGCCTCCGGATCTCCACGTCGTGACGCATCATGATGGAGCGCATCTTGCTCCACCGCATGGCACGATTCTGCATGATCTCCATTGT
CTTGGCATGTCCATGATGGCTGAAGTAGACGAGGTACATGCGGCGGATGCATAGACGGCGGCGGCGCTCGCGGCGCTGCGGCGGATGATATCCGCCTGAT
TCATTTTGCATTTTTAAAGTTGACTTGCGTTTTGTATGCTGCGGCATGAACGTCTGCGATCGAACCGGGGCCAGTTTATCACACCGCCTGGCTACGGGGC
AGCTGGCCCGTCGGGTGCTGATTTATTTTATCATCGATCGATTTGTATGCAGTTCCGCCAGTTGACAAAAAAACCATCGAAACGCTGAACGCCTCCTGTG
ACTAATGGACGCCAGTATAATAATTTGCCGACGGGTTGCTGTTGGGCCAAAGAAGGCGTTTGATTGGCCACCGGCACCAGAACACGCATGATGATTGGCT
GAATTTCGCGAACCCTACCCCGTCTGATCGGGCGCACGCTGTATTTTTTTAATGCAAAATAATTTTTGCTGCTTTTTTACAGGCGACCGCGGGTAAGTAT
CGCATACAAATTTCCATATACTCGCGCGACATGTGCCCGCCGGCCGGCCCCGAGTCATTCTCGCATTTGCCGGCCGCCAGTCACCACCTCCTCCGCCATG
TACTCGCAGACCGTCCACGGCATGGCCGCCTACAACCCGTATACGCTGCATGACGACTCGCACCTGCGTCAGCGCTCGTCGCCCATGTACAGCTACAGCC
AGGCGCCGCGCCCGTATATGCCGTACGGCAACCAGAGCCCGACCAAGTACCACCACCACTACGACGGCCACCACCACCATCACCACATGAGCCAGCACGA
CGATGACTTTTACCTCGACCACGCTGCGTTTACGATTGTGCCGACGGTACCGACGCCGGAAGAGCTCACGCGCTACGAGTATGGCCGCACGCCGTCCGGC
AAGGTGCTCGTCACGGCGGGCAACCAGACGGTTGAAATCTTCACGGGTGTCATGAACGCGCCGCCATGCTACATGGAGTAAGTAGCACGGTCGCTGCGCC
TCGCCGTTTGCTGTGCGCCAAGCCCGACCCGACCGACGCTGCTCTTTGTAGAGTATGGAACGTGTGTAAATAAGGCACGTCGGTCGGCACGACTTGCGAC
GCGGCGATCCGGGGCGATCGACATTAGAGATTGTAGGCCATATGAGTAAGAATAGCGTGTACGATGAGAAGACACGCTCGTATTATCTATTAATAATATG
TTAATTCTTGATACCCCACATGATTTCTTATCGTCCTTCAGGATGGCATGATGGGGTTTTCCGAGATTGATGATGTGATGTCATGTATGATGTGGCTCGC
ACCCAAGAGGAGCGTGGACGCGCGCCGCCTCTGCGCGCTTCAACTAGAGGCACGGTGTATCTTTGTGCTGCAGAACGCGGATCTTGGCCTGTCTTGGTGT
ACGGTACTGTTGCTCGTCGTGTCCCATATTGCCTATCCATGTCGCCGTAGCTGCACGAGGCGTCCTCGTCGGGCCGTGCCTGCGCCGACGCTTTGGCCGC
GGCCAGCGATGTATCGTGTCGTCGTCGTCATCGACGTTGCCAGCCGGACGCCACATCACCTGCCGCCTTTCTCGCCGGCATGGCGTTGCGTTTTAAAATC
CGCGTCGCTGATTGGCTGACATTTGATGGACCACGTGGCGCTACTCCAATCACAGGACGTGGTTGCATTGGATTACGAATTCACTATTGCGGGTCCTGGG
CCCGGATCGCGAGCGAGGCCGCGGAGGCGTCAATGGCCTGCGCAAAGGCCGCGACCCACTCGTTGAGCTCGCGGAGAGACTCGGCACAGAGCCGAAGCGC
AGGGTTGGACTCGTGCAGCACCTAGCGTTGCGTGAATGCGACGTGTTTGGAAGCGCTATGTGCACCTTGAACTGGTGCGGCCGCCGCTTCTCGCTCTTGA
TACGGATCGAGTAGCCGCTGAGCTTGTACACTTCGACGGGTGTCACGTCGTCCTCGTGGAGGTAGATACCAACGGACCCTTTCCGAATCAGGAGCACAAA
GAAGAAGCGCTCCCACGCTTTGTGGAAGCGCGTGCCGACCATGCGATCGAGGTAGCCGCGTTTGATGAGCGTCACTTTTGCCGCTTTCTTTGGGGGTGTC
GCTGCTATGGCATCGTCGCATGAGTCAAAGAACAGGAGCGACCGCGTGCATACGTGGCATGACGGGAGACGGCGCAATGTCCTGCGTTGGCTCGAACACG
CCCTCGCCGGCGCTTGTCGACACTGTGCTCTCAACGTCATTGGGCTGACCCAGTAGTAGCTTGGAGTCGGGCGCGATTTCGTGGCCGGTAGCGAGGACCT
TGAGAATCGGTGCCGGGATTTGCTCAATGCACTGGTTGCATACACGTTGCTTGCGCTGGGGCACACCAGGAAAGAGCCTTAGCCCAATGCGACTCGACGA
GCACGGCGCACACACAAGCCGCGAGCAGCGTCGGCACTGCAACTGCATCAACACGCTAGCAAATAGGCGAAGACGCTTACGTGGTGACGCCGGTTGAGGA
GTGTGAACCCTTCACCGCAGTTGGAACACGCGTACGACGACGAGTCGAGCGTCCACTCGGCCTACAACGATGTGTCCATAAGGTGTTGGCTGCGTCCGTG
CCGTGTACGAGCAGCGCGACATCGGGCGTCGCGGGGCTGTTCCATGTCGGCACGACGTCTGTGAGCACACGGATGTACTTGACGGCCGCGTCCGTCTTGG
ACATACGCCCGAGCTTTTCCCATTTTTGTCTAGTACATGTGAGTGACAGGAGGCGCTACATGGCAATAAGGTCGTACAAGCGGGTTTCGCCGGCAAAGCG
CCCGCAGCAGCCAAGCCATTTGGACTTGTTGCCTACGGTTGCATGCATAACGTTAGTACGATGCTCGAACGCAGGAGGTGCGCACTGCAAGCGAATTGAT
TTGCGCGGTAGTCGATGGAGCCGCGGTACTCTTCGCACGGACCGTGCAGCACTTGCTGCTTTAGTGCCCATAGCACGTCGTCCCAGTTGTGCAGCGGCCA
TACGCTCGGGTCCACTGCAACAGGATCCGACTGCAAGCGCGAGAGGAGCGTCGACGCGACCTTCTCGGCACGAAGGAACGTCGACGTGAGCTCCTTGTCG
TTGTCGATGAAGGCCAGCGCCATGAATCGGACTCGTGAAACGGGCTCCAATCTTTTTTTGATCCGAAAGGACGAAAGTGCCGCTTGGTGTTGCACGATCT
AGATCTGGGCCAAAACCAGATTCTCCGCCAAGATCTTAGCCCTCCACGAGCACCAATGCAACGCTATACCTACACTGCTACGCATGACAAGCCAAGACCT
TTGTTCTCCTTGAAGAACTGTTGCGACGGTGCTGTCGACAGAATTGCCCTCAACTCGCAACTGCAATGTCATCTGTACGACCTCGGGGATGACCACGATG
TCGATACGCACGGAGGAGATTTTGCCGACGAGCTTTGCACGCGCCATGAACCTTAGCCTTTGGAGGACCATTGATCGCTTGCTTGTGAGAACTGCAGTCT
GTCGAAGAGAGCTGCTGGTGTGTGTTGAGAGAGTGCTGTCAAGGAGTGTTGATGGCTGCTATCACCTGCGTCCGGATATTGACAAACGAGCGATCCGGAT
ATGCGACCAACCTCGCAGCCAGTTGGGATTTTTTCGATTTTCGAGCCGAGCATGAGCAGCAGCGGCAAGCCGATGGGGAGCGTCTCGAGCACGCCGCCGC
CGAGCAGTAGTGCGTCGCCGACCAAGAGCGTGATCCAGCACGTGCGCGACATCAAGGAGATGGAGACGCCGCGCCTGCTCCGGTACATGCGCGTGGGCAA
CATCCTCTGCGCGATTCTGCAGATCTTTGCCGGCATCGGGGGCATTGCGTCCATCATCACGTTCAACCTCACGGCCGTCTTTGTCTCGGTGTACATCATC
ATGTTTGGCGTGCTCTTCCTCCTCTTCGAGTGCCGCCTCTCGCGCTTTGACAAGAGCCTCCGCACGAACTTTGGCTTTCTCTACTCGTACAAGGGCCGCG
CGTTCTTCATCTTCTTCATCGGCTTTATGGACTTTGGCACGGACGACGGCCTTGGCTACATCGCCGGCGTCATCATGTGCATCAATGCATTCCTCAACTT
TTACGCCATGATGCGCCACCCCGAGTTCAAGAACGGCAACCTCTCGTCGTCCTCGGACCCGACTGTCGGGTATGCGGCCGCGCACCAAGAAGCCCAGAAC
TTTATCTCGAAGAACCCGAACATTGCGATGCAAGCGACCAACTACGCCTTCTCGCAGGCCAACGCGGCCGCGCCCTCGTATGGCAGCCAGTCGTAATCGA
AGTGATTCTTTGCCATCGTGTGCGGCGATCCTCTTGTGATGCAAGGCAGTCGTGTAGCTGATAGATGCAGTAGTCGAGCTTACTTTGCCGAATCGAGGAA
CTTGCGGATGCGCTCGAGCATGTCGGCCTTGATCGAGTCGGGCACCGCAGCGCGGCCCTTGGGTGTGATCTCGTCGACGAGGTCCTCGACCGTGATTTGG
TTGATGCCTTTGGTCTTGATGAGCTCTACACGCATCCGATGACCTTGACAATACGCACCGATAGCACTGCACCTTTGCAGTATGTGCGCATTTCGTCGCG
CCAGCCACACTCGGTGAGCTTCTGCCGCAGCGCTTCCTTAAGCCTACGATCAAGGATGAGCATAAGCGAGCACAGTTGCGGCATGCCGCCGTACCGCTCC
TTCTCGCCCGACTCGACGAGTCTCTGGTTGATCGTCTCCTTGACTTGCTCGTCGAGCTTCTTGCGGTACTCGTAGGATCTACGCCACGTCGTCGCCATGA
GACTCTCGAGTCGATGGACGAGAGGGAGCGTACTCGGCCATGATGGACGGGCTTGTGTTGTGGGCAGCTGGTGGTTTTTCTAAGCATCCGGATACGGTGC
CACCAGATAATTGCCGACATCCAGCCCCAGCTGCCAACACACGCCACATCGATCGTCCAGCAGCATTTCTAGCTCTGTGCATCGTTCGCTTTGCCTGTAG
CGCGCTTTGCTCAGCGGGCGCGTCCACTGGGCGTGCGATGTATTGCCGCGATGAATCCAGCACTTATCTGGTCTTTTGGTCGAGGTACCGTATCCGGACA
AACAAATCTTTGACGCGACCCTTTGGATGCTGCCAGCGCGTCGCGGGTCCAAGGCGGCGCCGGTAGGTCCAGTGGCCATGACTGCAAGCATGGAGCTGAG
CTGTAGCACAAGCAGACCGATGCGAAGAGCAGCCTCGATGCCAAGAAGGCGGCGAAGCGGAAGAAGTGGGAGCTACAGACGTACGTGGCCGCGCGCGACT
TTACCGGCGCGTTGACGCTCCTCGCCTTTGAAGCCAAGCACGGCAAGAGTAGTAGCCGTCGCACGAACGCGCTCTGGAGCGCGTACTGTCACTTTTACCT
CGGCGAGTACGAGCTGGCGTTGCAGCAACTCGACAGTGCGCTCGTACGCTGCCGCCACCATGTTGCCCCGTCTTGATGGATATCGCAGGCCATGGACGAA
GAAGAGACCGATGCTGATCACGGCGCCGACGTGCGCGACTACATTCACTTGCAGCGCGCCTGCTGCTATCTCTACCTCCATGTACGCTGACGGTCGCGCG
CCTCCAAATGACAATGCCACAGGAGCTGCCCACGGTGCACGACGTGCTCACGCAGTCGCTGCCGCCGACGCTGCGCCACGAGACCCTCCAAGCGGCACGG
TACCGCCTCGAGCTCGTCCTGGCGCAGCGCGAGGACAAGTCGATGACGGTCGCGTCGCGCCTCGGACAACTCTTGACGGCGAACGTGCGCGACCAGCTCG
CTGCCGCGGCCATTCTCTTCCGCCAGCGCAATTTTCAAGGCGTATACCCTTCAATGCACACTCTTGTCGATACGAATCCTGTGTCTACTAGGCCATGGAC
ATTTACAAGCGCCTGGCATCGCGGGATGAAGGGTACGCGGCGGTCCAGGTCTACCTCGCCATGTGCTATTACAACCTCGAGTTCTATGACGTGTCGCTCG
AGATGCTCAACAACTACCTCTCGCTCGACCCGCACAGCGTTGTGGCGCAGAACCTCCGCGCGTGCAACGTGTACCATCTCACGGACGGGTTCGTCGCCGA
GCAGAGCGTTGCGCTCTCGGTATCGCTGCCCCGTCCCCTTCGACCCGACACGTTTCTTCGGGGTAGGCCCACGTGCACAAGACCCACGTGCTTCTCGAGC
ACAACATTATGGCCTTCCGCGACACCGAGTACCGCT