Description :
From Genome Similarity Track
Location :
Scaffold_97:107048- 110086
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18949hypothetical protein
Phypa_INRA-310PPTG_18950mismatch repair endonuclease pms1

Sequence
3038 bases(100 bases per row)
TGGCGGAAAGAACACGACGTCGACACGATTCTTTTGCGCCCGTCGCACGTGTTCACGGACATGAAGGAGTGCTTCACTCACTTTACACACAAGAAGGACC
GCCTGGGTCATCCCATTTCGTTCGAGTTCCTTGGCGGCCAACGGAAGGCGCTACATGACTTCACGGCCCGAGGAGTCACGGAAGACGAAGCTATTATGCA
CCACGTGCGGATGATGGAGTTCATGTGGAACGTGATCGACCCGCGCCCATTCCCGGAAGGCAACATGCTGAAAATCTACGATATCAAGGGCATTTCCATG
GCTGATTTGTCGAGTGATGTGGTCAACTACACAAAGAAATGGGGCGAGGTGGTCGCGACGTACAATCCAGAGCGTGTCTACCAGGTTTTCATCATCAATC
CGCCTGCGTGGTTTAACCTCATCTGGAAACTGGTGTCACCACTTGTCAACCCCAAAACTCGTGAGCGAATCCATGTACTTCGCGGACACAAGGACATCAC
AAAAGCACTGCTGGAGTTTGTCGCCCCAGAGAATTTGCCGAAGGAATATGGCGGAGAGTGTCAGTGCGAGGGTGGGTGCTTCACACACTCCCCCGAAGAA
AATGATATTCGTGAGTGGACCGAGTTCGTGAACGCCAATTACAATGGAGACGAGAATGATCCAGTCCTCATCGATGCCTACAACAAACTTTGTGAGAAGT
ATCACAAACAACTGCCACCTCCTGGCTCCACCGCCAACGCCACTCCTGTGCTACCAAGCGGGACAACACCTTGAAGCTAGATAATTATTCACATAGCCGT
ACATTGAAGTGGCTGGCACTCATGCGCAGGACGAACCTTAGGCTTATGCGCTTGATTACACGAAATTAATTGCTGTCGTTGCTGTCTTCGAGATGCATCA
AATCAACTAAATGGCGGAGAGTCGGTCGACTGTACGATTCAAAGAATGCAAGTTAGTTACAGGTACGACACAGCAGGCAAGATAACGTACCCGTGAGGAC
AATTCCACGGCTGGTCCAGTCCGGAAAGGTTACGAACAATCTGGAAGACAGCAATAAACCATCAACACCATCTGCCAGTACATGTATGCACCGCTTTGAT
CTCCTTACCTTCTGCATTTCCTCTTTGTGAAGAGCGGTTCCAATCATGATGGAGCTTCTGCACGCTCGGGACGCAAACATCGCCATCACTTTCGGCAAGC
GGATAGTAGCTGGGTTCAACGGTGCATCCATGAGGAGCGACGCCAGTTCTCGAATATCTGTTGCACAAGTTGCAAATAAGTCATAAATTTCTGACAAAGA
GATAGCACAGCTACCACATTACCTTCAGTACCGAACTGTGTGTGTTTTGTGAAAGGCAACGACAGCAGCTTCAACTTCTTTGTAGCGGGAGCGTCCTTGT
CTACTAGGAAGGTGAAGCCATTCTTCGCAAAAACAGCCAAGTGGTCCAAGATGATCATTTCTTCTCCAGCTGTCAGCTCTAGCATTAGTGGGCGGACAAG
GGGTTGCTGGTGCATTACTGTGGTCTGTTGAAGCGTTTCGTAGTTGAATTTTTCGTCGCTGGCGTGCTGGTCGATAATGAACAGGTCATTGTCCAGCTTG
CCAATGATAAAGCCAAGGTTGAACTGACCAAGAACTTCCATGCGCTTGAAATCCTCTTTCTTAAGCACGCGTTGCAATGCTGCTGCTGCAAGCTCATTGT
CTGTTTCGACGGCAGTACCATCGACAGAGGTTGAGCACGTCTTCGGAACCTTGAGGCGGTTGGTCTTACGTTTCCGCTCATATTCCACCTCTTCCTCAAA
ATACTGTTGCCGCTGTTTGATCATCTCGTCAAAAGACCACATGTACTCTTCAGGCGTTGACGGGGTCGGTTGTGACGGCATGGAGCAATAAAGCTTCTGT
CGTTTGGCAGACTTCCGCAGATCCAATAGGATCTCTTCCGGGGATGATGGCGCGGATGCAGTACTTGTCTTTGGCGACGAAGAGGGCTTCGGCTCTTGGC
GTGCTTTCACCTTCTCTTTCGGATTACCAGGTACACGATCTATGCTTTCGCTCCGTGGAATTTTTGGCTGGAGAATTTCGACAATCACGTGTTTAGGCTT
CTGCTCCTCAGCTTCGGGCTTATTGTCTTGTGATTGTTCGTTTTGCGAAGCAGCATTCGTTGGCATGTCATCCTCATCTCGACTTTCCACGGCGGGGATG
CGCTCTGGCTGTCCGGGAGTATCCTTTTCTGATGCTTCCAGAGCAGATTGCTTGGCAGTTTCTTCTGTCTTCGTGGATCGAGCGAACGCTGTCATTAAAG
GTTGAACTGTAAATGTTCCTCGACTTGGTTCGTAGAGCTTGTTTAGACCCGTTTTGAATGCATCAATAATTTCTGCCTCCTGTACGCCATAACACGAATA
CCTATTAGCGGTGAGGTTATCGAATTCCAGAAATATGAGCTTACATGCTTCACAAATGTCTCGCGTTTGTCCGGAGTAACATTCACGTCATAGTCGCCCA
ATGGAAGCAGAAAGTTGAGGACGCATGCTGGCTTTTGTTTCATTTCAAATTGCCGCCAAACTTCGTTCAGTGTCTTCGCCATCTATGTAGTATTACAGAC
TTGTCAGTTGCAAACCACACTCCCATAGCTACATCCATCAAGCATCCTACGAACCTTCGGAAGATCAAACGGGCGTCCGTTGATGAAGAAGAATTGTCGG
TCGTTGTCGCTCCGGCCGACACCAGCACCTACCTTGGAAACGTACCCCTCTACCTTGCGCTCTTGTCCACTCAGATTGTCTTCAATCTCCACAGCGGAAC
TCTTCTGCTCGCCATCACTGTCACCCTCATCACTTGCATCATCCTTCTCGTCTTTCTCGCTCTTCCCACTGCCCTTCAGCTCAAAATCTACGCGGAGGAG
TGTCCTGAAAAACTTTGTGCCGAATACATTGGCAATATTCTCCCCCATCGTCTGGTGCGCTTGAGTAGCCAGTACAACATGTCGACTGGCGTTCTTTCCA
GTGATATTAAATACACAGATCTTGACGTTCGCGCAGCT