Description :
From Genome Similarity Track
Location :
Scaffold_640:10703- 16764
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_640-fgenesh-gene-0.4Tyrosine aminotransferase
Pytul_var.sporangiiferumsnap_masked-pug3_contig_640-abinit-gene-0.20Glycoside hydrolase
Pytul_var.sporangiiferummaker-pug3_contig_640-snap-gene-0.13GTP-binding protein PTD004

Sequence
6061 bases(100 bases per row)
TCCGAACTCTCGCAGCTGTGCGCCAACCCGATCCGCAAGATCGTCGACAACATCAAGAAGCCTGAGAACACCGACAAGACGCTCATTCCGCTCTCGCTCG
GTAAGAAGCGATGGAATTGGCTGTGTGTAGAGGGGATATGTGGTTGACCTGGTATACATGTTTTTGTTTTTATTTTCTGTATATGAAGGCGACCCAACGG
TGTTTGGGAACTTTAAGTGCCCCGACGTGTTGGTGGAGACGATTGTCCGCAATGTTCGGTGCGTGTTTTGCTGCCTGAGCTCTATAATTGTACCCATTAT
ATGCGGCAGAGACGCTAATGCGGAAGGATCAATATGTTTGGTGTCTGTATAGTTCCATGAAGCACAATGGCTATATCCACTCGGCGGGAACGGAAGAAGC
GCGTGACGCCATTGCCAAGAAGTATGGGAGTCCGAGCGCACCACTGACCAAGGATGTACGTTACCTCCAACACATTTTTAGGTGAATTTGATCTAATTGT
ATGGCTTGTGTGACTGGTTTTGAATCCAGGATGTGATCATCGCGAGTGGAGGCTCGGGTGCGCTCGACATTGCACTGACTGGTCTGCTGAACCCGGGTGA
CAATATCTTGCTTCCAAAGCCAGGATTCCCACTGTACCAAGTGATCTGTGAAACCCACAAGATCGAGTGCAAATTCTACGACCTTCTTGTACGTACACCA
TTCATGTGTTTGCCCAGTGTCATGTTGATCAGGCAAACTGACGTAGGATTTGCTATTTTGACAGCCTGAGAACAACTGGGAAGCAGACTTGGAAATGATG
CAATCCCTGGTTGATGAAAACACCAAGGCCATTTTGGTCAACAATCCGTCGAACCCTTGTGGAAGTGTGTACTCCAAGGCACACTTGGAAAAGATTCTCG
CTCTTGCCGAGTACAACAAGCTTCCAATCATCTCGGTAAGCGCTGACACATCTCATTTCATATTGGCATGCTCAAGAGTACCATGCTCACGTGTTCGGTC
AACTACTACACAGGATGAAATCTATGGAGACATGGTTTTCGGTGCAAACATGTTCTACCCACTCGCTGCGTTGACCAAGACCGTTCCAGTCATCGCGTGC
GGTGGCCTCGCCAAGCACTACCTGATCCCAGGCTGGCGAGTGGGTTGGGTCATGGTCAACGATCGCAACGATGTGTTGAAGGATGTGCGAGCGGCGTACT
TCAAGCTGTCGCAGTTGATTCTCGGCGCCAACTCGTTGGTCCTGGTAAGAAGAAGCACTGACGGTGGCGGTGGAGTCAACTATTGTTCTTCATAGCTGAC
ACTTTTTCTCATGTTCTTTCATGCAACAGAGCGCTATTCCAGATTTGCTGACTCCAGCCCCTGGTAGCGCAGAGGCCGAGTCCCTTGCTGCATTCAAGAC
GCACTACTTTGGCACGCTGGAAAAGAATTCCAAGTTCACGACGGATGCCTTGAGCAAGATCCCTGGCCTCAAGGTCGTGGTGCCGCAGGGCGCCATGTAC
GTGATGGTTGGTGTGGACACGAGCATCTTAGCGGGCATCAAGGACGACTTTGACTTTACCCAGAAGCTCCTTGACGAAGAATCGGTGTTTGTCTTGCCTG
GCCAGGTACGATTTCTTTTGTTTGTTTCTGCTGGCATTGGGTATTGACTTGGCTGACATGATCCTGTGTTATGTTTGTCTTTGGCAGTGCTTTGGCATGA
CCAACTATTTCCGCATTGTGTTTTCAGCTCCGCACGACGTGTTGAATGACGCATACACTCGCATTGCCAGCTTTTGCAAGCGCCATCAAAGCAGCTAAGC
GAAGCAGGAAAGAGCGAGCGACAAACAACACAAGGATATAACCAACGAGGGTGCATCATGCGTTCCCTTTCATGTATAGGCGAGGCGAAAGCCGCATTAT
AAAGCAACTTATCATATATCATGCATTCATGTGCATCAAAGAGATTTCCCTCTTTCCATGTATATAGTTCAGTGAACCTTATGGCTTCACAGCGTATGCA
GAAGGTGGACAAGTTATTAGTCAAGTTCCCACACCGGAGGCTCAGTAATGCCGCGCGATCATTGTGAAAGAAAATTACGGTAATGCCTTTTTCACATTTT
GGGTGATAAATCATCGAGTGTCATACGCGTTTCGACCAGCATTTAACAGCTTTTGGATCTGGATAGTTTAGTGCTGCAACATGGGCTCGTAAGAAATTGG
ATGCTCTGTATTTGCATGCTAGTGGGCCTGGATGTTGAGCTTCAATATACTTCAATCAACATAATTGGTAGTAATCCACCAATATCATTTTCTCATTTTA
TGCATAAACTATACAACACTATTCTCAGCTTTGTCATGCTCTTGTACAGTTTTGTCAAAATGGGCTAGGTAAAAGAGCACAATGATTCGCTTTTTCCACC
AATCACGGCTTTCGGTACAAAAAATTCAGCGCAAAATGTAACCCCTCAACTCAGTAGGGGCTTCTATTCGAATGTAGGTGCTTTTCCCTCAATGGGAAAC
CATCTCTTCCCCATACAAAAAAAGCGGTTATTCGCAGTGGTGGCTTGAGAAAAGGCAAAAGCAGGAAAGAAGCCAAAGCAAAAGATGGTGTCGCTGTCCC
CGCGCTGGTCGATGGCGGCCGTGCTGATGGTGCTCGCGCTCGCACTCATGGCGCACAGCAGCGAGGCTGCGCCGGCCGACGGTGTCATCCGTGTGCGCGG
CAACAAAATGTACAACTCGAAGACCGGCGAGCGCTTTTTCATCAAGGGCGTACGTTCTTGCTACCGCATTCTATGCTTTCCATAATGGGAAAGCGCGTCT
GTGCATGTTGTATCCGACGTGACTCATGTGCGGCGTGATGGTGTGTATGGAAATTTGTATGCAGATGACCTACGAATACGCTGTGAGTGATACCTACTAC
AACCAGTACTCCAAGGCCATTATCGCCAAGAACCTGAAAGGCTTGAATTTCAACACGCTGCGTGTGTACAACATCAACCCGGACGAGTCGTACAAGGACT
TTATGACCGACATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTCGTGTCGGCGTCACCGGATAATGATGAGTACTTTGGTAAGTATCG
TTACTCGACGATCACTAAGGCGCTTGGACCGGACGGCAAAGTCACGACGTCCTCGAACGGCGTGAAAACCGTGGACCAGACGGAGACCTGCTACCCTGCG
CTGCTGCTGGAATACGGCAAGAAGATCGCCAAGAACTTTGCTGCGTACGATAACACGCTCGGTATTATCGTGGCAAATGAAATCATGCAGGTGGATCTGA
CTGCTGCCGCGTGTGTGAAGCAATACGTTGCCGATTTGAAAAATTGGATGCGCGTGAACGGCAAGAAGATGCGTATCATCCCATTGGCGTACGCTGCGGC
TGACAGTAGTTATGCGGGCAAGATTGACAACGCCGATGATTACCACGTGCTCAAGATTCAAGGGCTGCTCTGTGGCGATAAGATGAAGGACGGTTCGATG
CAGAAAAGTATTGATATCTACTTGATCAACGAGTACCGTTGGTGCCCGAAATCGACGTTTGCTCAAGCCTACCAGCGTCTGATCAACTTTGCGCAGGGTG
CACCCATCGCGCTTGCGTTTGGTGAATATGGTTGTAAGGAAGACTCTGCCGTGGCAAGAGACTGGGGAATGATTCCGTACTACTACGGCAAACCCGCTGA
CACAAACAAGTTTTCTGAAGTTTACTCCGGCGGTCTGGCATACTCGTACGGTCAAGCCAAGCTCGCTCTGGACGCCAAGTTCCCAATGTTTACTGGTGCG
GTATCTGAAAATATTTATCTATCTGTGCATTGTATTTTGCATCAGGGTTATGTGCTCACGATATCTTTGCTGAACCATTGTAGGTGGTTCCACGGATCCA
TTGAAGCAACCAAGTACCGTACCTTCGGCCGACTACACCAACTTGAAGGCGCAGTTTGACAAGTACGAGCCATACTCGGATCCAGCTGGATGGTCGACGA
CCGATAAGTGTACGTGGGCTCCAACTCTTGCGACTACCACTCAGGCGAGTAACACGCGAGCGACGGAGAATGGCTGGATTGTCGACAGTTGCACTGCTTC
GTTTTTGAAAGTGGCCGATACCGACACTTGGGTCGCCAAGAGTCGTGAAGGCATTGTGTGTGATGACAGCGGTGGGAAGTGTGACGTGGCTGTGAACTCA
GTGGTTGGTACGACGGAAGAAGATTTGTGCGGTACCTACGAAGTCACGAGCGGCGGCGATGCGTGCGAGACATCTTCGGATTGCGGCGTGAATGGCCAGT
GCTTGACCGTCAACGGCGAAAAGGCGTGCAGCTGCCTCACGTGCTACACCGGCTCAGACTGCAGTGTGAAGGACATCAGTACGTGTAGCACGCTTTCGAA
CAGCAAGGATGCGCCGAAGATTATCTTTGCGGGTGTGGGTGTGTTCTTGGTGATCATGCTCGTGGTGTTCGTTGCTCTTGCCGTTGTCGCGCAGAAAAAG
AAGAGCGGTACGTGCTTGCGACTTTTTTTGCTGAGTTTGTTTCTTTGTCTCTTGGCTATTATAGATGGCAGTTGATCTCACACTGTTGATGACGATTTGT
AATTGTAGCAATGGACAAGCTAGGTGACCAAGTGAAGCTTCGCAATCCCGGAGCCGCTTCTGCCCAGACGCAGGGTGCAGCACTTTAACTGGGTATCACT
CACTCCCTCTCTGACCGTCCTGGCACCTCCGTTCATTGGAAATTTACAAATACATGTTGAAAAGAAAAAACACACACACTCTCTTGTGAGGCAAGCGAGA
CACTACATGCACTTACTCTGGCTCAGGTACGCCTACTGTTCCTCAACCAGCAACAGTTGACACCAATGGCAGCATGCCACTTTCCTGGCGATTTGGTGCC
CTCTTTTATGAATTCAAAGAATTCAATGTGTACATTCAACATTGCTCTTTTCTACCAATGGGAGCGTTGATGTATAAAACATATAAACGCATTGTTAGAT
ATGTTTTATACTTTCCCTCGCTCTGATGGCTTCTGAGCGCGGTTGCGACGCCATCCATTAGTGTCGAATATCCTCAAGCAAGTGAAAGCAAGATGCCGCC
AAAGAAGAAAGTCGAAGAAGTACGTGCCTCTCCTCTTCCTTGTTGCGCTGCGTGCACCGGCAGTATATACCTCATTGTGTAGCTGAGTTCGCGATGATTC
TCGTGATGCGATTTACACTCGCGGAAATCATGGCGAAGCATGTTTCCGCACGCATTGAAGACGATGGATCTTTTTCTCATTTCTCCTCATGCGTTTGGTG
TATGCATTCCTATCGTTCCTGTTATCTGTAGGCCCCACGTGTTTACCTTGGTCGTCCGACCAACAACGTGAAAATCGGCATTGTCGGTGTTCCAAATGTC
GGCAAGAGTACATTCTTCAACTGCTTGTCCAAGCTCAACATTCCTGCGGAAAACTTCCCGTTCTGCACGATTGAACCGAATGAGGCCGTCGTGCCATTGC
CTGACCAGCGTTTCAATTGGTTGGTCGAAAAGTACCAACCTGCCAGCGTGTACGTCTCGCTCTTGTGTCTATGATCCTGGAGAGGTTACTGTTTTTGATT
TTGCATTTGACCAACCCATGTGTTTTACTCCCACATGACAGTGTGCCTCCAGTGATCGCCATTACCGATATCGCTGGTCTAGTCAAGGGTGCTGCTGAAG
GTGCCGGTCTTGGAAATGCCTTCCTGTCGCACATCCAGGCCGTCGATGCGATTTACCACATGGTCCGTGGTTTCGACTCTGCTGAAGTGACCCACGTTGA
AGGCAATGTTGACCCAGTGCGTGATATCGAGATCATTCAGGAGGAACTCCGTTTGAAGGATATCGACCGTGTCACGAAGCTTGTGGATGGCATGCGCAAG
AACGTCGAACGTGGTGTAGGCGGCAAGGAAAAGAAGATGGAGTACGAAGCGCTTGTGCGTGTGAAGGAGTGGCTTGAAGCGGGCAAGGATGTGTCGTTCG
GTCAATGGAGCGCGTTCGAGGTGGATGTGCTGAACCCATTGCAGTTGTTGACTGCCAAGCC