Description :
From Genome Similarity Track
Location :
Scaffold_48:10703- 12316
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_48-fgenesh-gene-0.2Myosin

Sequence
1613 bases(100 bases per row)
CAGAGTTTGCTCATCACGGGTGAAAGTGGCAGTGGTAAGACCGAGACGTCCAAGCATGTGATGCAGTACCTGACCACCGTaTCCACACGGAACCGTGCCC
GCTCGGCCGCGATCGCCAACCGCCGCATGTCTGTCGCCCAGCGCCAGGAGCTCGATAACAAAATCGCGCACGTGACCGACGTTCTCTGGGGTTCCAACCC
CGTGCTCGAGGCCTTTGGTAACGCGCAGACCATCCGTAACAACAACTCGTCGCGATTCGGCAAGTACATCGTGTTGGAACTCAACCGTCTTGGCCAGGTC
ATTGGTGGTTACATCGACAACTACCTCCTCGAGCGCTCGCGTATtATTTACCAGGCCgAGGGCGAGCGTAACTTCCATGCCTTCTACCAGCTGCTTGCCG
GTGCGAGCGACGAAGAACGTGAGCAGTGGAAGCTGAAGCGCGCCGAAGACTACGACTTCCTCAACAACACGGACTCTCGCATTGAAGGCGTTGATGACGC
AGCCAACTTCGAAGTTGTGCGCCAGAACATGTCGGCCGTCGGTATCACTGAGGAAGAGCAGCGCGAGATTTtCCAGCAGCTCGCTGCACTCCTCTGGATC
GGTAACATTCGCTTCCTCGAGACGACAGACGAGGCGCACAATAAGTGTGTGAAGATCGAGGATCcGGAGAGCCGCGAGGCACTGGAGACGACTGCGAAGC
TGCTCGGTCTGCCAGTAGCCAGCCTCGAGGAGATGATCACGTTCCGTATGCTGAACATCTACGGCGAATGGCAGAAAGTGCAGTTCGACAAGCGCCAGGC
GAAAAAGGTCGTGGACTCGATCGCTCGTTCCCTGTATGACCACATTTTCAACTGGATCGTCGCCCGCATCAACAAGAATGTGACGTGCAACCAGCGGGAT
GTAGCATCGAGCATCGGCATCcTCGACATTTACGGGTTCGAGATCTTCGAAGTGAACGCGTTCGAGCAGCTCTGTATTAACTATGTGAACGAGAAGCTTC
AGCAGCTTTTTATCGCTCAAACgTTGCGTGCTGAGCAGGACGAATACAAGCGTGAAGCTGTCAGCTGGCAGCCGGTCGAGTTCTTGAACAACCAGAGCGT
GTGCGATCTGATTGAAGACCCTAAGATTCATGGTATCTTCCCACTTCTTGACGAGCAGTGTGCCATCGCACGTCTCGATATTCTCGAGCTGATTGAGCGC
TACAACGCCTCGCACGCTTCGCACAAGCACTACATTCGCTCCCGTActCGTGGTCCACATTTCACCATCATGCACTATGCCGGCAAGGTCGAGTACGATG
TCACTCTCTTCTTCGAGGCCAACGTGGACACTTTCTTCAACGACATGTACAAGAGTATGGGTGAGTCCACTGTGCCATTCGTGCGCGAAGTGTTTAAGGA
cAAGCGCACTGACGAAGAAAAGAAGAAGCGTCCACCGTCGACCTCGCAGCAATTCCGCACACAGGTGCAGAACATGCTCAAGAAGCTTGAGGGCTGTAAC
CCTCACTACATTCGTTGCATCAAGCCGAATGAGAagAAGCAGCCACTTGTCGCTGATGAGGCGATCATCAAGGAGCAGGTGAGCTACTTGGGTCTGGTGG
AAAaCCTGCGTGT