Description :
From Genome Similarity Track
Location :
Scaffold_41:1070224- 1072099
Sequence
1875 bases(100 bases per row)
TGCGTGCGTCGCGTCGCCTTGTGAACGGCGAAGCTAATGTCTGGCCTTGTACACCGCGCGACCCAGAGCAGGCTACCTACGAGTGATTGGAATCCTCGGA
TCGTCGGTTGTCCGCGGGCGGCTATCTTCGGTAGCAGCTCCAGTTTCTTGGGCTCCACCTCGTTACTTTCTTCTCCGATTGGCGCCCTGACACCGTTCGC
CGTTGCGAGCCCGTGTTATTCCAGCAGCTCCTCGATGACTGTCTGCTGGTCGCGATTGTAGTCTCCCTGTTGATCCAGCTCCACACGCATGCCGAAAACT
TTCCTCGCCTCGCCAAAATCCTTGATGGACAGAGTACTCATTTCCGAGAAGAGCTTCTCGACTAAGCTGGAGACGGACGCGGTGACCAGAAGGTCGTCCA
CGTATTCGGCCACGATCGTCATCTTACTGCCCTGCCTCTTGTAGTACAAGCACCTGTCCGCGACGCAGCGCGTGAACCCGAGCTTCTCGAGTTTGGCGTG
GAGCAGCTTACTCCACAACCGTCCGGCTTGCTTCAAGCCGTACAGTGACTTCTTCCGCCGTAGTGCCAGCTTGGTGCTGTTTCTCACGTTGAACGACCGC
AGTACTTCCTCCGGATCTCCATTTTCTTCGGGATGACCAGGTAAATCTCCAGGTGCTGCTCCTTCTCGGTCTTCACGTACGCGTTGGGGATGTCCCCGTG
CCTCGCAGGCACGCCCCAGCGCCGCGCAACACCAATATCACCTTGACAGTGCTCAAATCCATCACCGCGGCAAACGTGAGCCCGTAGTCGATACCGAACA
ACGGCTCGTTTCCGCATGCCACCAGCCGTGCTTTGAATCGCTCGATGGCTCCATCGGCATTCGTCTTGGTCTTAAAGACCCATTTTGTGTGCAACACATG
GCTGCCCGTAGGCGGTATCGCCACTGTCCACACCCCGTTCTCTTCGAGCGCTCTAAGCTCCTCAACCATCTCTATGGTCCACTTGTTCCTGAGCTGGCTC
TTCATCGCATGCGCGTAGCTCTTCGGATCTGGTTCTCGCACGCTATTTACCACATCGAGGCCCGCGGCCGCGTTGCCGTCAGGCTGACCGTCTCCATTGC
TCTTCTCTTCTGCAGCCACTGCTGCCTTTCGAGATGCCAACCTAGTCTGGTGCTTCTCTCGAGTCCACCGACTCTTCGCACGACGCTTCGACTTTGGCTT
TGGCGCCGCTACGGGTCCTTGCGTCTCAGTGGCGGCATCTTCCGTCATGGACTCGTCCGAGTCCTCCAGATACACGCGCCTCAGCTACTCGTTCTGCACG
TCCATGAGGATCTCCACGCTACTGACATGCTGGGTGACGACCACCACTTTGTCCTTCGGGATATAGACCCTGTACCCCTTCATCTCGTCGCTCTTGCCGA
TGATCATACCGGGCTTCCCGCGCTCACCCAACGACTTGTTCTTGGCGTCCTGGTGCACGGTGCACGGGGAGCCAAACACCACAATGACGCCGAGGTCCGG
CGTGCTCTTTGTGAGCATCTGCAGCGGCGACTTTAAGCCTGGGTTCCCCTTGCTTGGACTCCGGTTCAAGATATACGCGGCGTACTCCGCGGCGTCCCCC
CAGAAGCTCAAAGGTAATTCGCACGCAAACACCATGCTACGCACCATGTTCATTACGGTACGGTGCATGCGCTCCGCCTTGCCGTTGCTGGCCCGGTTGC
GGGGCTCGCTAACTTGTCTAGCAATGCCGGTGTCCTTGCAGAATAAGTCCAAAGTCTTGTACTCTTCTCCGCCGTCGGTGCGCAGCACGTGAATGCGACA
GTTGAGCTGCCTCTCGAAGAAGACCATGAAGTGCTTAAACTTTTGCGCCGCTACGTCCTTGTTCTTGGCTAGGAA