Description :
From Genome Similarity Track
Location :
Scaffold_9:107020- 113943
Transcript NameFunction/comments
Physo_155840predicted protein
Physo_129756hypothetical protein
Physo_129757Zinc transporter ZIP (ISS)
Physo_129758ZIP family transporter: zinc ion

Sequence
6923 bases(100 bases per row)
CTTGGTGCCGGCCATGATCAGGCATCCCGAAAAATAATAATACCCGAAAATATAACAGTATTTTCGGATACAATACTTTATTTAGGGCATCGCCGTTTGT
ATTATCCGAAATTTATGTAGCCGAGTTCTAAAATTCGGTATTTTACTTCTGCTCATCCTGCTCCAACCATTAGTTGTGGTCAAACATCGCGCTCTACCAG
CGTAACTTTGCCGTTAGCCCCCCCTTTCAAACAAGCACCACCCAGCACGCGCATCACGACTCGACGTTAGCACCATGACCGACAATCTCCTCGCTGGCCC
CGCTCCGAGGCCTACCTTCTCGCCCAGGCAGATTGCTGCCTTCTACTTCAAGCCCTGCCTGGACGAGGAGGGAAAGACGACGGGCTACTATGCCTGCAAG
ACCTCTGCTAAGCGCCGCAAGCACGCGCCCAAGTCAGGCTACAACAACTTGGTGTCACACGTGCGGGCGGCGCACCCCAACTACGAGAGCGACATGCGCG
ACGCTAATGTCGCTGCGACGAGGACCCTACTGCCGTGGGTCACCCAGAAGGCCTCGAACCGCTACGCGTGGCTGCGCTGGATCGTCACGGGCAATCTACC
GCTGTGTTTTGCGAGTCCAAGAAAACGCGACAGTACGTATTTTCATATCTATTTTGGTGATTTACATGTGTGCTAATGCCGTATGTTATGTAGATACACG
AAGCTAAATCCCATCTCCGTGGAGACGCTGACCGCCATCATGGAGGCCGTGACCAAGGCCATGGAGACGATGATCGGCGACGCCATGCCCGAGCGTTTTG
GTCTGGTCCTTGATGGGTGGACCCACGGCACGGAGCACTACATGGCAGTGTATGGCTGCTTTGAGACGGCGACAGGCCCCCAGTACCCGCTGCTGTCGTT
AGCGCCTGTCATGGATGAGCCTGACGACCAGCTGAGCGCTGACGGCCATCTGACGGCGATTAAAAGGTTCCTACCCTTTTTGGTAAGTCTATCTCCGGAT
GTCTATTCCTGGTTGGTGACAACTGCGGAGTAAACAAGCGGCTGGCGAACCTACTCGGTGTGCCGCTAATCGGCTGTGCCAGCCACCGCCTGAACTTGGC
GGTGCGAAACTACTTGGAGCCCCAAGACAGCATCCTCGAAGAGGTCCAGTAGCTTATGCGTAAGTTGCGGACTTTAAAACAAGCAGCCAAGTTGCGGTAA
GTACTCTGTTTGCTATTTTATTTGGTTTTTGTATTGGTACTAAATTGGTCTTTGTTTTTGGGTTTTGTTCGAAATTAGTGCCAAGACCCCATTGGCCGCT
GTCCTCAGACAGGACACGCGCTGGTCGTCGACCTTTTCAATGCTCAAGCGCTATTTTCGGCTCCGTCCGTTCATTTCGGCGGACGACGAGGAGCTCGCGG
ACTTCCTTCCGTCACGCTTAGCCCACCCCAAGCTGGAGACTTTGCTGGCAAGCCTCCGGGACGTCGAGTCCGTGTCCAAGCACCTGCAGGGCGACGGCCT
TACGCCCCTGGACGCTCGTGTCCTATTCGACGAGCTCCTCAAGAGCCACCCCTCGTTCGCGAAGTATCTCGGTAAGGATCATCGCTCACTCTGCGTCTGA
TGGTATTTCTACTTAGCTACTGCGTTTTATATGTTTTTATTTATGCATAGCCACCGACGCGGATATAGTCCACTCCGCCGTCTTCGAGCAGGCGGTCGTC
AAGGTGCTGGACGACCAGGCGGCCCTGCTGACGGACGACGAAGTCGCTGCGCTGGAGCCGTTCAAGCGCACGCAGACTCATGTGGAAGGCGTGGACTGCA
CGCCGGCGGACAAGGAAGGGTTCGCTGTGCGTGCGCTCAAGCGACGCAAGGTAGCTGCTGCGCCGGCCACGTACGAGCAGCTTAATGCGATTCCTCCTAC
CTCAAACATGGTTGAGAGGCTCTTCAGCATTGCGCGCGCTATGCTGCGCCATGAGCGCCACCGCCTTTCCCCCATGATGCTAGAGATGATATTATTCCTC
AAGATCAACAGCTCGTACTGGGATGTTGCGACCGTGGAGCAGTGCCTGTAAGTAGGTACAGTCGTAACATGCTTGCAGTAATTTACTGTGTCAACACTAT
GTCTTGCGTTATTTATTCAGTCTGCTACTCAGATGCAATGCAATATTTATTATGGTGTCCTGCAAACAATAGATATATATCGTATTTTCGGCATGCCTGG
CCATGACAGGCGCTGGTTAAGGGTGCCTTCCTTCTTTGCTTGCGGCCCTTGGAAGGAGAATAAGGCAGCGCTAGACCATAGCGAGTGTACCGTGGTATGG
TTACACAACACGTTGAACAAGTATCCTAAGTGCAACTTATACATCGCTACGGCTTCCTGCTTTTCACATGAACGCGGTCTCCGACAGAATTTTGTACGGC
AAAGGTCAGAAAACCAGCCAACTCAATGCAAGATGGACACGTGCAATGAAAGCTACGTAGGTTTAAAAGTGGAACAGGTTCGCATCGCTGGCAGCTACGT
TCGCTCGCCTCGAATGCGGCGTGCTCGGTGAATGTCCTTCGGCACAATCTGAAGTCTGGCATCACGCAATGACTGACGTGGAGACAGCGTCCAGGTGCGC
TCGCTGCTGGGTCCAGCGGCGCCGTCAAGCGCGACGAGCAGCGCCGTGGCGCCTGGCTCATTAGGTATCTGGCTCTGGCGAGCAAATCGCGGTATGCCGC
TCGGGCGATTAAGTTTTTCGCAGGAGCAGACCGCTGGGGGACGCGCGAGTGGTGCCGCCGCTGTCACCACCACCAATGAACTAGCCATCCGCTAACAACA
ACTGCGAGTGGTACGCTGAGCAATTGCTGCAGGCTGCACGTGGGATGACACCGCACTGGTGATCCCCACGGCGGTGACGAAGATCGCCACGGCACCGTTA
ACGCCATTGCCGCCGCCGCTTCCCGTGGATCATCTCAGCGAGAGTCGCAGCGAGTCGGAGGAAGCCGGGCGTGCAGCCCAAACGGGGCGGGTGCCTCGGC
GCCATTCAGCGAAGGTCTCCGCTGTGATTGGCTTGGCGCACGCGTCCGCGGCAAGGTCCATTAAGTGTGCGGTGTGCGCAGCCTTGTAGCTGAGCCGGAG
CAGCATTTTGGTGTTTGCACGCTCTGTTGTAGCCGCGAAGCCGCAAGACCGCATGCGCGTTAACTCAAAACGTTCAACAAGATATCGCAGGTCCCTCCTG
GACTTCTGAAGAGTCCGCGTTGCCCGCGTGTTATCACGTTTGGCAGACACCATCGCGAAAGCGGATCGCAGCTTCAACAACATGATGGCAACCCATCCGT
GAAGATCTCCGACGCCGACGTAGCAGGTGTGGCCGCGCTCATGCCTGTCCGCGGGGTGTCCGGATTAATACTCTTTCCAATGCCCTCGAGCCGAGCTGAG
CTGAGGGAGGTCTCGAGGCCCCAATGGGTCCAGCCCAGCGATGCGCCATCCAGTCGCTGCTGCCAGCCTCCCGTCTCACTCTGCAATTCGCAGGCTTCCG
AGCACTCGATCACTCCCAGCCATGCTCACCTGCGCCGCGCTGTCGGCCGCAGTGGCAGTCGCCGCCCTGGCGCCCGCCAACGCGCTCACGAACCTCAAGA
CCGACTGGGACGCCTATGTCAGCGCGCTGCCCATTCCGGACGTCATCGACCTGACGGCCGGCGGCTCCATCGACATGCAGATCGGCCGCGCCACGCACAA
CTGGACGGAGGACGGCTCGCTCTCGGGCGACATCTACGGCTACGCGCTCAAGAACTCGACCCCGACGATGCCCGGCCCGACCATCAAGGTCGCCAGGGGC
GTGCCGATCTCCATCACGTGGTACAACGAGCTGTCCCAGCCGCACCTGTTCCAGAACTCGGTCGAGGACTCGCTCAACAACGTCGAGTCGGCGTGCTACC
CGTACTGCGGCGTGCCGGTGGTGACCCACGTCCACGGGCTCGAGTCCCCGCCCGAGTACGACGGACTGCCGTACCGGTCGATCTACAAGAACCAGTCGCA
GGAGTTCCACTACTACAACAACCAGTCCGCGTCCACCAAGCTCTACCACGACCACTCGAACGGTTTGACCCGCCTCAACACGTGGGCCGGGCTCATGGGC
GCCTACATCATTACCGATGACGAACTGGAGGCGTCCATCAACATGGACATCGAGACGGACATTCCGCTGGTGCTGACTGACCGTCTCATCAACACGACGG
GCGAGCTGCTTTACTCGGACGACAACTGCAATGCCGGCGCCACCGAGTGGGTGCCCGAGTCCTTCGGCAACGTGAACCTGGTGAACGGCGTGATCATGCC
GTACGTCGAGGTGCCGCCCGCCCAGGTCCGCTTCCGCCTGATCAACGTGGCCAACGCGCGCCACTACAACATCACCGTTCCGTTCGAGGACAAGTGCCAG
ATCGTGGCCACCGACTCCGGATTCGTGCACAAGCCCGAGTCCTTCAGCGACTACCTCGTGCTCTTCCCGTTCGAGCGCATCGAGTTCGTCTGCGACTTCA
CCAACGACACGAATGGCACAACCTACAAGCTTATCGACAACGAGACGGCGGACCAGCCGACGGCTTATGATGAGCGCATCATGCAGATCCGCGTGGTGTC
GAGCCTCAAGACGGACACGATGGAGTACCGTGAGATCCCATCGACGCTTGTGACGTACAAGTCGCTCAAGGAGCTGTACGAGGCCGGCGGAAAGGAGCGC
ACAGTCATCCTCGGAGAAATGGACACGGCGCTGCAGTGCCCCCTGTACGACATGATCATGTACCGATCGCAGCAGATCAACATGACGAGCATCACGGGCA
GTCTGCACTGCACCAAGGGCACGGTGGAGAAGTGGAACTTCCAGAACCCCACGGACGACCCGCACCCGTTCCACTGGCACTTGGTGAACGCCCAGTGCGG
TGACACGGAAGAAACTATCGACACGAACCACCTGAAGGACGTCGCCAAGATCCCGAATGCCGGTGACCGCGCCACGGACACCATCACCCAGGTCTGCTAC
GTGGCCTGCACCCCCGACGAGTACCTCATTGCGAACAGCACCCGTGGCGCCAAGGACTACGGATTCGACACGACGGAGCCGTACGTGGCCCACTGCCACA
TCCTGGAGCACGAGGAGAACTCGATGATGAGCTGGTTCAAGATCATGGACGTGGACGACGGATACGCCGACGACAACGGCATCACTCCTGGCACGGAGAT
CACCAACACGGTTATCGCCACTGCCATGGGCATGAGTGTGCTGGGTGGCATTGCCACGACGCTGTCGGTGCTGGTGATCTCGGTGGAGCGTCTGAAGTTC
CTTGCCGACCCGCGCTCGCTCTCCATCGCCTTCGCGTTGTCCGCTGGTGTCATGATCTTCATCGCCTTCGCGGATCTGTACGCCGAGGCCCTGACCTACT
ACCGTGCTGCGTTCACCCCTGGCACGACGGACCCCGAGGCTTACGAGCACGGAGGAAGCACCACGTCTACCGGTGTTTGTGACGACACGTGCAACGGTAA
CACGTACCTGGCGGCCACGGGCGTCTTCTTCGTCGGCATCGCGATCATCCTGTTGGTGGAGTGGCTGGTCCACTCCGTCTTCGAGCGCAAGGACCGAGCT
GCTGCTGCTGAGGCTGCGGCCAAGGCGGATCAGGAGGACGGTGACAAGGCTCGCTTGGCGGAGGAGGGTGGTGACAAGGCCAACATTGTGCACATTGCGT
CTCCCGTGCCCGGCACCCCTCTGCCAAACGATGGAGCCCACGAGCTCGCCAGTCCTGCTGGAGAAGAGTCGGCGGCTCTTATCGAGGAGAGGAAGGTGAA
GGAAGAGTACCGTCGTGCGGGTGTGCTGACGGGTATTGCTATCGCCATTCACAACTTCCCCGAAGGCCTGGCGCTGTTCGTGTCGTCGCTTGCCGGTCTC
CGCACGGGTATCGTGCTGTCCGTGGGTATCATTCTCCACAACTTCCCGGAAGGTGTGGCTGTGGCCGCGCCCGTGTACTACGCTACTGGAAGCAAGGTGG
AGGCCTTCAAGTGGACGATCATCAGTGGTTTCGCGCAGGTGCTCGGCGCTGGCATCGGCTGGGCTGCTGTTTCGGGCGGCATGAGCTACGCTCTGGAGGC
CACGCTGTACGCTCTGGTGGCTGGTATGCTGGTGTGTATCACCGCGAAGGAACTGCTGCCGGGCGCCTACAAGTTCGACCCGAGCGGAAAGCTGTTCGTG
CCGTCCTTCTTCATCGGTATCGCCATTATCGCGCTGAGTTTGGTCGCGCTCAACTACGCTGGATCAAGCTAAGTGTAGAAGAACCCAATCTTTTTAAACG
TAACGAGATGAATGCAAAGTCTGTGTCAATTGATTTCTAATGCCGTTAGCGAGTTGATGGTAGGCACCGGTAGATTAGCCGGAGCCGGCGTACTTGAGAG
CCATGACGCTGAAGGCGATCACCGCCATACCGACGAAGAATGCGATCACGAATACTTTCCCCTTGGGGTCGAACTTGTAGGCGCCCTTGATCAGTTCCTT
CACCGTAATGCAGACCAGCATCCCAGCCACCACGCCGTAAAGTGACGCCTGGAGACCAAAGCTCATTCCCCCTGAAATGGCAGCCCAACCGATCGCTGCC
CCCATCGGCTGCGCGATTCCGCTCAGAGCCGTCCACTTGAACGCCTCTAGCTTGCTTCCAGTGGCATAGTAGACCGGTGCAGCGATAGCCACACCCTCGG
GGAAGTTGTGCATGATAATACCGATCGATAGCACAATACCCGACCGAAGTCCCGACAGTGAAGAGACGAACAGGGCCAGACCCTCGGGGAAGTTGTGGAT
GGCCACGGCAATTCCCGTCATGACGCCAGCGCGACGGAATTCTTCCTTCGCTTTAAGTCCTGGCACCACGGGGGCTGTGGCCTCACCGGGCCGTGGACTC
TCCAACTCGCGACCATGTTCACT