Description :
From Genome Similarity Track
Location :
Scaffold_933:107- 3495
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_933-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_933-snap-gene-0.6Novel protein
Pytar_ATCC12531maker-par_contig_933-snap-gene-0.8Conserved gene of unknown function

Sequence
3388 bases(100 bases per row)
GAGCAACATGAGCAGCTTGGGGCTGCGCAATTGGCGGTGCGTCTCTGACTGCCCACGCGAGGCGTCCATTGCGATGGCTGATATAGTCGTCTAATGCGGT
TGCTGTTGGTGACTGCAGGGGGCAGATCGTCGAGCCGCTGGCGAACTTTGCAGCCGCCGACGTTGCTCCTCCACCGTCAGCAGAAGGTGCCCGAGACGGC
GATGCGTCCGCCAAGAGCGACAAGAAAGAAAAGAAAGAGAAACACAAGAAGAAGAAACACCCGCGGAGACACCGTGAAGGCGATGATAGCGAAGACGACG
CGGTCGTGTTTGTGAAAGACGAGTTTGGCCGTGACGTGCCCGTCGGCAAGTCCCGCAAGGAGGAGAAGAAACGCAAGAAGCACCGCAAGCGGTCCCGATC
GCGATCACGATCACGATCACGATCTGCCGACGCACGGCGCCGAGCAATTACACCACCACCTGCGGATCCGATCCGCCCACTGGTGAGGGATCCACAACCA
CCTGAATATTCCCATTCATGAATGCTGATGGTATGTTCTTTCGGTAGCTCGACGACGGACGTGACAACCGCCCCAGCAGCAGACATCGTCGTCGTGACTC
GAGAAGCCGCAGCGGCAGTCGAAGCCGAACTCATAGACGACGTCATGCGAGTCGCTCGCGCAGCACGAGTCCGACCAGTCGACGCTCGTCTCGTCGGCGA
CGCAGCAGTCGATCCAGGTCGCGATCGCGGCCGCGGGCGACCGATCGAGCGTGGACACATGATGGGTTTGAGAACCGCAGTCCGAGTCCCATTCGAGAGG
CTGTGCCTGGATACCAGCCCGAGCCAGAGCAATGGGTATCACGAGCCGGTGGCGTCTACTTGCCTCGCCGGCCGTAAACCGATTTTAGCCAGTGGTCGCT
CGCTTGTTCTCAAGCTCCGGAAATAAACGTGAATAGACATCGAAGCGACCAGCTAAAAAATCTCAAGGATGAACGCTGTGGGTCGCTGTAGTTCGTCGCT
CTTGCGAGAATGGGATCAAGGTAACATGCAGTACCCTTGCTGCTAAACCTCCAGCACCTCCACTGATCCATCCGTTCTCTCTCTCTTTCTTTCTCAGCCT
CCACTAGTCGACGCACACTGTTGCTGCAGTGGCTTCTCACAAGGTTCCACGACACGCGAGAGAGCAATGCCCAAGAGGGCGACTGTGGGGCCGATGTCTC
CCTGTTGTTACCCCGTATTATCGTGTGGATGGATAGGACCAAGGAGCACCACATCAGGTCCCCCGCCGGTTCATCCCCATTAGACGAACAACTCGCCTGT
ATCCAACTCTTCCTCACGTCGTCCAACGCGCACAAGTACCTCCACGAGTTCATTCAAGCTGACGGACTCCGCGTGCTGCTGCACATCCTATCGACCGACG
CACCTCCGCACCACCACGGCGTGGCCGCTCGCCATCGCTGTACGATCTACACCGTACTATCTCGCCTCGCACAGCGCGGCCGAGCGTTCAAGGAACAGAT
TAGCAGTCTTTATGGTGAGCTGTCCATGGCACGTGGTGTGATCGCGACGATCGACCACTCGGAGAAACCGAATCTCCAGTCGCCCGTATGGACACTGTGT
AGAATGACACTACTGGAGCAGATCGCGGGCAACCGCGCGAGCGTTGCCGTCTCGTTGGACGCACTTCTGTTCATGCTGCGCCACGAGGTGGATCCGGTCC
GCCAGTTCGGCGCCCAGATTTTGAGGGAGCTCGTGAGCGAGACCTCATTCTTCTTCGACCACCATTTCCGCCAGGCCACGCACCACACACTCGTGCCGTT
GAGTGTGGAGCTATTGCACTCTACCCACATTCCTCTGCAGCACGAAGGGTTGGAGTTGGTCCACGCACTGCTGCAGATGCCGTCGAACAGGGTGGGTCTC
CTTCACAACGAACGGATTGGGGAGTATTAGTCACCGTGAAACGAACCCGCTCTTGCTGTAGAAACCCATTTGCTCGCATCTCGCTCGGTGGATCCACGAC
GCCGCCGTTGCTGCTGACCCGTACGTCGAGCAGCTTTAGTGTCAAGAGATGGTCCTCTCAGTATCTTTGTTTGAGCCTGTAGCGTCGAGCCAGCCTTTGC
GGCGATGCAGCATACGCGCGAGTACGACATGCTGGTCCACATGCGGTCGCCCTTTGTGCACGCAGCACAGGCGCTGACAACGCTCATGCACTGCGCGCCG
TCTATTGTCCCGCTGCTGGCGGAGACCCACGAAGTGCTGATCCCCATGGCGTTTGTGCTGACCGCCGAGCGGCCCCAGTCGCTGAAGTGGCTCGCCGCCC
TCACGGCGCTCCACTTCACCTTTAGTCGGTGCCGTCAAGTCGCGGCCAGCCACTTGAGCCAGCTCTTCCTCGTACCAATGGATCAGCTCCTGGATCTGCC
GAGTGTCCTCACGCCCGAGGCGTTTGCCGACGAGCTGCTGCGAGATGAAGCCACCCGAGAGCTCGTGCGGTGCCATTTCTTTCGCAACGGATGGGTCCGC
GCCATTCCGCCGTCGTCATCCCTGCAGAGTCAAGAGGCTAATGATGATGACGGCGACGAAGACCCGTCACTCGCTGCGATCGAGTACGAGATCGATGTGG
CTGTGCACCGCGTGATCCCGGGACTGCCTCTTCATACAAAGTACGAGTCTGATGACGACGAAGAGGACGATGGGGAAGGCGGTGAGTGTGTCGATTTCTC
AACCGAGAAGCTACTGCGCGACAAGCTGGAGCGTCACTTTATGAAGTACCGAGTATTCCCCAAAGCGTCTCCATCCACGTAAGATAACAAGGCGTCCATC
CATACAAGTACATGCATTTCATGTTCTTCTTCCCACCCCTAGTTTTCCTCGGGGGCAATGTGGTCGTCCAGATACCTCGTGACCGACTGGAGCTGCTCGA
GCACGATCTTGACCTTTTCGCGGGCGAGCGTCGCGTCCTTTTCGGCGCCGTACGTGCTGCGGCCGTACGTGCGATAGTCCGAGACCAAGTGGATGTGGCT
GGCCAGCTCCGTGTGGATCTCCTTCACGAGCTGCAGGAACTCGGTCGTCGCCATGTTGAACGCCATCGTCGAGCTCTCTTCCGACGAGCGGCGCGGCGTC
AAGTGGTTGATCGCCGTCGCTGCCGTGCGCAGCGCGCTCACGATTTTCTACACAAGAATCAAAGTCGGAGAGTTATTAGCAAACATATTTACGCACGCCT
TACACGCTTGCGGACGCCGGGAAAAACAGATTTAAAGAGCGGAGACGCACCTGCTCGACGCTGCCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCACGGCGGCATGGCGCGAGCCCGTGAATGGGTCGCTGTTGTCCGAGAAGTGCACGCGGCCGTCGAGCTCTGCCTCCAT