Description :
From Genome Similarity Track
Location :
Scaffold_1634:107- 2324
Sequence
2217 bases(100 bases per row)
TCTTCTTCGTCTTATTTCACCACTTCAACCCGATTCCGTTTAGCTCGATCACGTCCAAATTCCTCCAACAATGCACCACAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAAATTGCCTTCCCAAGTGTCCTCCGGTATTAGGGCTTGATCAAAACCCA
CTCGTTTGGTTTCTTCTACCTCCAGCCGTGCAACANNNNNNNNNNAGGTAAACTTTGTACCAATTTTAGCTTAGCGATTTGCACGAGCGGGAGCAGTCGG
TATGCGGTCCCTTAAATTCAGCCGTACTGCAAGTTCCCCACACTTCTTGATCACCTGGGCCATGCCATATATGAGCCAGCTTCCTGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTGT
GCTGATCAGCCCGGTCCTGAATAGCTTATTCTAGCCGGTCATTCACGGTGATCCGAGAACGTTTGTAATGTCGCTGTATATCATAGCTCTATGTCCTCGG
ATCACGATCACGCGTTTTAGTGCATCCCAACGAAAGGGTTTCTTCCAANNNNNNNNNNNNNNTGAGATAAAACGGGGTGTCACTCCGGACTCGATCATGC
GCTGTATTATTGTTGAAGGTCAATCGCTCGGCGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTGCCATTTGCCGGAGGCAGATACGCCATTGTAACACGCTGATTTTGACCGGCAATAAGTTTGAATGCGCGAAAGAAATTCGACATGAA
CCCAGATTCGCGATCATGATGATTAGATTCGATCGCCCCAAATCACCGGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCTACCACGATCGTTTAGGTTGTCCTCGATGTGCTAGCCTTAGCGATCACGTAGCCGGAAAACNNNNNNNNNNTCAACCCAAAGATGCAATTCAGTGTTT
TCTTTAAATGACCGTGGTAGAAAAGGTATATGATCCATTGTGATAATCTGAAACGGTTACGTAGCTTGCATGTTTCCCGTGAATTCTCCCCGTAGCATAG
GGCATCCCTTCCCGGTATCGCAGTCGACACACNNNNNNNNNNCACATACTGCTGCACACTTCGGAACAAACCTCTCCAATAGAAGTGTGATCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTATTTTGAAGCAGATTCAGGATCACCAGACGAACGAGCTTAGCCCGATCATCGGGATTTGTTGCCGGTCGTGGGCAAAAATACAACAATCCGCCT
TCCCCTACCACGTATTTTGGGGCAATCACGGCACTTAATTGTGCTTCTGCAGCACCCAGATCTGTTACATCTCCTACTAAGTAAATTTTGAGGTTAGCGG
TACAACTTTCTTTGTCTTGCGCCTATTTTATATGGTCGAGTCGTATCTGCTGTACTATGTCTTCTTGTATAATGGTAAACGTCTCACGCCTTCGCAGGTC
GATCGTGTAATCGCCACCATATTGATCACTTGATCATTATTGCACGCTGACATCAATATTTCGTCCAGTCGGTNNNNNNNNNNATCGTCCAGTCGGTTGA
TGGCGCTCAGATCGTGGCGGTCCTGACCAGTTAGCATAACCATGACGCAGTAATTGTAGCCCTGGTGCCTTACAATCAATATCGCCCCCCATCTGCCTGA
TGGCCAGGTTGGAATCCCCACATATGAACACTCGTCCCATTGTCGGTTTCGATAGCAGCTTGCAATTTAGCAGTAATTTCGTAATACTCTGCCTCGTTTA
CTGTTAATCTAGTTTTAAAACGCGACGCAGCCGACAATTTGGCACACTCGGGCAATTCCATATCACTGCACTGTAGGCGTCCCCTTTTTCTTAATACGTG
CTGACCCATCAGAGCTG