Description :
From Genome Similarity Track
Location :
Scaffold_766:107- 2042
Transcript NameFunction/comments
g17300.t1hypothetical protein

Sequence
1935 bases(100 bases per row)
TGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGG
CAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTAGTTAATAGTGGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAG
CTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGGTATCCTTTCGTACACTTCCCGTCCTTCAT
GCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGTTGCGGGAACTTTTCTCTGTCAGGAAGCTCT
GCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACT
CGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATC
GGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGACTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCG
AATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGT
TGAGAAAATGGGTATCACCACCTCGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTG
AATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCTGTATTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCG
CATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACAT
GTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATACGGAAGCAGAAGAGG
ATACTGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGTAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCG
TCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGT
CGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCGAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCAC
AGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGATCCGTGCGCTCT
CCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTG
CATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGC
TGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTTGATTCGCCAGGC
CACTTCCAAGCGCCACAATGTTCACAAACAGTGGT