Description :
From Genome Similarity Track
Location :
Scaffold_1115:107- 1712
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1115-snap-gene-0.8Conserved gene of unknown function

Sequence
1605 bases(100 bases per row)
ACTCGACGCGCTGCTCCGGGATCCGGTCAAAACGCCGCGGGCCGACCGTGGAACACCGCAGGCTCTTCGGAGGCCCAATGCTGACCGAGCCGCGGTAGCT
GCCGCCGACGAACGAGTTTTGGCCGCCCTGGGCGAGCGCCGACCGCCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGCAAATGT
AGTGACCGGCGACTCCTTCGGCCGGAATCATGTACCCAAAAGTCACCGTGCGGATTGCACCTTCTCGTACGCTCGGGAGCCCCTCGACGGGCATGACGGG
GTCAATCTGGAAACTCGGGTCGTTCGTAATGAGCTCAATGCGAATGTTAAACATACTCGAGACCGCGTACAGCTCGGCGATCGTAGCCTGCTCGTCGGGC
GTATCGCGAAACGTCTCGTACCGCTCCGTGAGATCGTCGACCTCTTGCATGAGGAACGCCGCCAGCGGCTCGACGTGCTCGAGCGCATAGTCCATGAGCT
TGACGCGGAGTAACTGGGACGCGGCAATGCGTCGGGGCGCCATGCCGTCGGCGGCACCGACGTTCACAACGGCCATCGTCGACGGGTACTCGCGGAGACA
CTGGAGCGGAAACATCTCGTACACGACGCAGTGGAGCAGACACGAACCGTCGGGCGGCATGCCCACGCCGAGCAAATCACACTTGAGCAACTGCTCTTCC
ATCTTGGCGCGCTGCTGGTCGAGCTCGGGCGTGATCACGTTGGACGGCGTCATGCTCATCATCGTCGAGTTGCGTGCCATGGACACGGACGGACGCATGC
CTCCCGATGGCGTCGTCACGTGCTCGACGATCGACTCGGTCATGGGGAACCAACTGCCCCGCGCGCTCGAGGACCGGGTGGAAAACGAGCCACTTGGGGT
CATGAGCGGCTGGGCATTTCCGGTATTGGGTCTCGCAAAGCTCGCGCTGCCGACAAAGCCCGTGCCGGACCACCGGTAGTCGCCGTGCTGCGGCGTCGTG
GACGAGTAGTTGGACGACGCGACCGACGTGAAGGTCGAGCTCGACGAGACGGAGCGAAAGTCGTCGTCGTCATCGCCCATGACGCTCGCCGTGTCGCGCA
TCGCGGCGATTTGCGGCGGCGCGAGCACCGACATGGACGGCCGCAGGACCGAGTCCTGCTCGTCGTACTGCGGGTTCGAGCCAAAGCCATTCGTAAAGCC
GACAAACGCCTTCATGGTCTGGCTCTGGACCGACAAGACGTGAAACGCCACGAGCTGCGGGCTGCGCGTGAGCATGGTCAAGTAGTTATCGAGCTCGCGC
ATGCGTCGCTCGAGAAACTCGGTGCTCAAGTTGGCGCGGAAAATCGAGCGGCGCCGGTAGAGCGGCGGAAACTTGATGCCCTTGAGGTGCGCGGCATTGC
GCTTGCGGAGCTGCTCGTCGAGCTTGCGAAAGGCCGTGAAGCCGCGCCAAATGTGCCAGCTCGTGGACCCGACCGAGTGCGTGCGCGACGAGTAGAAGGA
GATGTGGACCACGACCTTGAACTCGGCCTTCTTGTTGATGCGGTAGTCCTGCACGTGGAGCGTGCATGCATAGTCACCTTGGATCTCCTCGGGCGTCATG
ATCAG