Description :
From Genome Similarity Track
Location :
Scaffold_2081:107- 1626
Sequence
1519 bases(100 bases per row)
ACTCCGAGAGGAGATTCTCCAGCAGTACCATGACGACTTTCAAGGCGGACATCAAGGAATTCTCAGAACATTTGAGAGGCTCAAGAGAGACTTTCACTGG
ATCGGCATGTACGCTGACGTCGAACGGCATGTGAAGGAATGCGTCGACTGTACGACCGCGAAAGGAGTCCCAAGAAACCCCGGACCGTCACCAGGCAACA
TATTGCCTCTGGAACCTTTTCAGATAATATCCATGGACTTCGTGATACCGTTGCCACCATCCAAGAAGGGAAATACGGCACTGCTGCTGTTCCAAGACAT
GTTCTCGGGATATGTAGTCTGTGCCCCCATGAAGCGCACCGAAGCACAAGATGTGGCTGAAGTCTATGAGAAGAAGGTCTTCAGATACTGGGGAGCGAGC
CAGATTCTCCGGCACGACCGAGATCCAAGGTTTATGTCGGAAACGTTCCAACACTTCAGGGATCTCATGGGAAGCAAACAACGAGCCACTCTCTCCTACA
GACCACAGGCTAATGGGCAACAAGAGCGTTCCGGACAGACAATTGTGAGGAGCATCAGAGCGTATATCGCAGAATCGGACCAAGGAGACTGGGATGTAAT
TGCAAAGCGTCTGACGACTTGCATTAACAACTCTTTCGACTCCACAAGGATGGAAACGCCGTTCTACCTCACACACGGCTGGGATGCGTGCACCACAATC
AAAGGATCGCTTGGACGATGGCCAAGAGCGTTGACCCCGAGAGCAGCTTACCTCTGGAGAGCTCAAATCCAGCGGGACTACGAATACGCGAAGCGATGGG
CTCTAGACCTTCAGAAGAAAGCGAAGCAAAAGAGATCAGAGCACAGAACGGCGTTGTGGACAGCTCTCTCAGAGAAATTCAAGAAGGGCTTCGATGTCGG
AGACGCGGTGTGGCTGTACATTCCGAGGGTGAAGTCGGGATTGAGTAAAAAGCTCGCGCACAAGTGGCACGGCCCGTTCAGAATCTCAGAGAAGGGAAGC
GATTTCCGATACAAGCTGAAGATTTACCGACACGAATATCGCTTCTATCCCTGGGTGCACGTGAGTCGTCTGAAACCGAGAGTCGTCTACCCTGAGAGGC
CAACCGAAGAATTGTCCGAGGTTCCAGAGGAATATGACTTTGACGCTGAATTGTTGCCTGAAGACAGCTGGGAACCCGACGAAGAAGGCGGTGAATACGA
AGTGGAGGCTCTGGCAGACTGCCGATGGACCAAGGCGACAAGGAATGCCCGTCAGAAACGCGAGTATCTCGTGAAGTGGAAAGGTTATGAGGAGCTCGAG
TGGGTCCCCAGAGAGAGACTGAATTGTGGGAGCCTGCTCTACGAGTTTGAGCGCCAGAACCGTTCAAGAGCACGATTTTCTGCGATGCAAATGGCGGATG
AGGACGAAGTGGACGAGGAAAGCTAGCCCGTGCGTCAAGAGTCCGAGCTCTCTCAGGGATTTATCCCTGGGGAGCGCCAGTTGCGCGTGGATCTGAACAA
CTTTACATATTTTACATGA