Description :
From Genome Similarity Track
Location :
Scaffold_1820:107- 1277
Transcript NameFunction/comments
Phyta_totarag13717hypothetical protein

Sequence
1170 bases(100 bases per row)
aagtattTGTTCATTTCTGATATTGGCTACAACGGGGCCACCCATGTATTGACCGAAGCTAGCCTTAGAAGGGAAGAACCAGGAGCGCCACATATATTCG
TCTAGGTAAGTGTGTAGTCTGTCCTTTATCATGCCGCGCATGCTCTTAATGTGCCACTTTATCCGGGTCGCTCACAGCCTCTCGATGGTGTTCGTATGCG
TACCGGTGATGGGGTCGACAAAGTTGAGGCTGTGGTTTACCCAACTATGAGTATAGTGCATACTCAACAATAGGCGATTGTTCTCCAGAgtgtgctgctt
gttgccACGCTCGCAAACGTAGGTTGCAAATGTGTCGGACATGATCTTACTTCTACAATACAGCAGGTACAGATAACGTTTGTGGTACCtcaaaatacat
gtaggacACCAAAAACACTCATCGTGGTTCGATGAATTTCTTGATTATGGGGAGAAATGACTCCTTCGTGCGCTTGTCGTACACGATGCGACCAAACGAG
CGGCCAGTTGTACGCTCCACGCCGCCGAAGAGCCAAAACGCCTGGTAATAGCGGCCGCGGTTGTACTTGCGCTTCTTAGCGAAGCTAGTTTCATCGATCT
CTACCCTGTCCCTTGCCACCGATCTGCAAACATAAAAGCAACATGCAGCAACATTAGCGCAACCTTAAGCACCATACAGGCAACTTACGATTAAGTTTAC
CTTGAACTCCGCCTTCAGCAGTTCCTTGGAGCATGTTGCTCGGCAGAAGGCATACCAGTCCTGCACGGTACGCTCGCacacctccaccagctcgctTGCT
TGCACTTGAGACAGCCGCATGCACCAGGCTAATAGTAGCCGCACCGCGcgatgcagcttcaacttggaaTCGTTAAAAACCGAACTCGTGAGCATGCCAC
GGGATACCTCCTTTCCCGTGGCATGCTCTGCGCGGCGAGAGCACCGCCAGCGCTTGCGCGCAAACGACGGCATCATGTCGAAGCCGCAGGTCGGACagag
cttggccttgtcgATAAGCCCCACCAGCGTGCGCAGGTCTCTTCGTCGCACGTCACCTCCATCACTttggagatgacgacgagatTTTCGTCGGTGAGAT
GGCACTGGAAGGGAGTATGCATGTTGTAGGGCGGAGCGGAGGGCTGGTGAGCTTTGATGATGCGAATTTA