Description :
From Genome Similarity Track
Location :
Scaffold_28:106986- 109148
Transcript NameFunction/comments
Physo_133803hypothetical protein

Sequence
2162 bases(100 bases per row)
AGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCTCCA
TGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTT
GCGATGTGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGTACGGTAGCAGACGTAGTCGCACCACGCCCACG
CTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCG
CGCACGTCCAGAATGGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTTTT
CCACCTCGCTCCAGATCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGCCTTCTTGCGAAGCGTGGT
GAACTCCTTCAGTGTGAGCTTGTGTTGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGGGCACGCTCA
TAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGT
CCCGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGTCTGGCATACGCACCCGAGCTAGCCGCGTGGTATTGCTG
CTGTTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCG
CGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGACAGTCGCTTTCGACGCTTGTGCACGCTCACGACCTTGTGCCA
GCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATAGCGACTTCGTC
GTGCGACTGCTTGATGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCC
GCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGCCGTCGGGTGAACTCTCACCGGTGTACTGGACCATCGTGCAGTCAAAGA
CGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCTGCCTAACG
GCCACTCTCCAGCGTGCTGCTACGAGAGCGCACTACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGGCTCGTCCTTGGCCTTGACCGCCCTG
GTCTTTGGCCCTACGGCCCGCGGTTTCGGAGGTACTTTCGCACTGCGCGCACTGCGCTCTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTG
CTCGGCGATACGCCAGTTGCTCTATGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCG
CCGGCGTAACCTCGCTCTGATCGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAACAGTGACCCTGTCACTATTCCGGGAT
GGCTACATCGGTCACTCCCCTGGATAGTGACCCAATTGGCCTTAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATG
CAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTATCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGT
TCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACA