Description :
From Genome Similarity Track
Location :
Scaffold_1:106964- 109542
Sequence
2578 bases(100 bases per row)
CGGAATCACTCGGCTCCCCGGGCTCTCGTGGAAACACTTCCTTCGCGATCTGAAGGCTGGTGACATCGAGCAGGTGTGCTTGATCACCGAGGCCGACGGG
ACAGCCGAGGGTCTTCACGCACTCAGCGGTGACGACGCGTCGTCGCGGCCGAGGAGTGCCGAACCGAAGTCTGCCCGCGAAGAGCGATTCGCAGCGCAGT
CCTGGGAAGCGCTGAAGAAGTCGGGTAACCCAGTCTACGATACCGCGCGCGAGTTTGAAGACGTCTTCCCTGATGAGATCCACGCCGAGCTTCCAGCCGA
CCGCGGAGTTCGGCACGAGATCGACCTCGCGCCCGGAACGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGAGACCAGGTCAAGGCCATCGACGAG
TTCTTCGAAAAGCGCCGCCTGGCCGGCCACGTCCGCGAAAGCACCTCCCCACACTCTAACCCCACGTTCTGTGTGAAGAAGGCGACTGGCGGCTGGCGCA
TCGTCCACGCGTTCAATAAGCTGAACGACGCGACCATCCCGGCACAGACCCCGATCCCGCGGAAGGACATGGTACTCGACTCCATGTCAGGTAGCGTCAT
CTATAGCGCCATCGACCTGACGGACGGCTTCTACCAGGTCCAGCGACATACCCCTCACGGCAGTAAGCACCCCCAGCGGAATGCTTTGGGAGTGGCTCGT
GATGCCACGGGGTCTGAAGAACGCCCCAGCCACGTTCAACCGCATGGTGTCTCACGTACTGCGCCCGCTCCGCGACTTTCCTCAGTGCTGTCGAGGTCCA
TCTTCAACACTTGAGGCAGGTATTCCAAGTGATGCGCGAGAACAAACTGTACGCGAATTTGAAAAGTGCGTCTTCTGTGCGCCGGAGATTCCCGTACTCG
ACTGCTACGTGAGCAAGGACGGAGTTCGCGCAGATCCGGAGAAGGTCACCTCGATCTGTTCTTGGCCAACTCCCAAGAACCTCACGGAGCTGCGTCAGTG
GCTGGGTCTGGCGAATTATCTCCACAAGTACACGAAGAATTACGCCGGACTGATCCAACCGCTGTCTTCGCTGCTGAAAAAGGACGCGACGTGGTTGTGG
TCCCCCGACCACCAAGCTGCGTTTGATTCCGTGAAGAAGAGCTTGGCGGAAGCGCCGATCCTGATGCTTCCGGATCACACGAAACCGTTCCATGTCGTGT
GCGACGCGAGTGATTTTGCAATCGGCTGCGCGCTGATGCAGTTCGACGATGAGGGCCACGAACGCGTCGTGAGCTACCAGTCACGACAAATGAAGCCTGC
CGAGAGGAATTACCCCGTCCACGACAAGGAGCTCCTCGCTATGCGCTACGCCCTGGTCAAATTCCGGGTGTACTTGCTCGGAGAGCAGACATTTGCCGTG
TACACGGACCACGCGTCGCTGCGCACCGCAATAAAGACTCCACACTTATCGCAGCGCATGGCGCGATGGCTCTCGTTCTTCGCCGAATACAATTTCGTGG
TGCACTACAAGCCCGGCAAGAACAACATCCTAGCCGACGCGCTGTCCCGCCGACCAGACTACGACCCACGACGACTAGTCGGTCAGCAACTTGCTGACGA
CGATGACGAAGATGAAGGCTGCGCATGTTGCATCGCTCTGGGTATCAACGCGACGATTACAACTCCAGTCCTGCCACTGCGCCAGCAGATTGCTGATGCG
TACGAACACGATCCGTTCTACGCCAACATCATTGCGCACCTCCGTACTCCAAGTGCAGAGTCATTGAAGAAGCTGACACGCCCTACGCGCAGTCATATCG
AGCGATACCAGCTCGATGGCCCATTGCTGACATACACAATGGACGCCTTCGATCCTCCGCGCGTCGTCATCCCCGCCGATGACGACCTCCGTGCTCGTCT
CGTCCACGAGTATCATGACGCTCTAGTGGGTGGCCACTTAGGCCGCGAGAAGACGTTCGCGGCGATCTCGAGGGACTTCTATTGGCCTCGGATGTACAAG
TGGATTCGCAAATGGGTTCGGACTTGCGAGACTTGCCAGCGCGTCAAACCAGCTCCATCATCACAAGCTCCGCTGCGCCCGTTGCCTATCGCCACGGAAG
CGTGGCGATCTGTCAGCATGGACTTCGTATTCGGCCTTCCATCGGACGACCAGGGCCGCTCGGGCGCCCTTGTCATCATCGATCGCTTCAGCAAGATGGT
CCGTCTTGCTCCTGTCGAAGCCCAAGTGACAGCTGAGGCGACCGCGTCCCTGTTCCTCGACCTCGTATTCCGGCATCATGGCCTGCCGGAATCCATCGTC
TCTGACCGCGACCCTCGCTTCACATCGACCTTTTGGGATCGATTGTTCGAACTGCTTGGCACGCGCTTGTTGATAACGACGGCAGCTCATCCTGGAACGG
ATGGGCAAACGGAGCGCGTCAATCGAGCCGTTGAAGATGTCCTTCGCAGCTACGCCACGTCGTTTCCGTCGTGGAGTACGTTCCTGCCGCTCGCCGAGTT
CGCTATCAACAACGCAGTCCATGCGTCGACATGTTTGACGCCGTTCTTTATCAACAACGCGCGGCATCCGCGCGTTCC